Skip to main content
This is a pre-production deployment of Warehouse. Changes made here affect the production instance of PyPI (pypi.python.org).
Help us improve Python packaging - Donate today!

A Python package for designing influenza reverse genetics primers using the seamless cloning methods (e.g. Gibson assembly, CPEC assembly).

Project Description

# FluGibson

![Travis Status](https://travis-ci.org/ericmjl/flu-gibson.svg)

A tool for designing primers to clone influenza polymerase segments from viral cDNA.

# Installation

The installation requires the following packages:

  1. networkx
  2. biopython
  3. pandas (optional)
  4. matplotlib (optional)

From Github:

  1. Download this repository as a Zip file.
  2. Unzip the file.
  3. In your terminal, navigate to the FluGibson directory.
  4. Run command: python setup.py install

From PyPI:

  1. (if applicable) Switch to your proper Python environment.
  2. Run command: pip install FluGibson

Using Conda:

  1. (if applicable) Switch to your proper Python environment.
  2. Run command: conda install FluGibson

# Usage

## Scripted

One way to use FluGibson is to use the provided script in the /examples directory. Copy the script to your working directory.

Create the FASTA formatted files containing the DNA parts that you want to stitch together. For example, you would use the following FASTA definition to stitch the following 3 parts together:

>PART_1 >CATCTATCTCTCTACTGCGAGGCTATTCGACTGGCCGTTACTCGCCGGTACGTAGCTCGGTCTCGATCATCAGTACGTCTACGTGTCGTCGTACTTACACGGTCGCTCGGACTGACGTACGTCTACGTCGTCTGACTGA

>PART_2 >CTACTGTCTGCTGATGGTACGTACGTGAGTACGCGCAGCACAGACACTACTTACTCTCGCGCGAGAGCTATCTACGACTACGTACTCGTCGTACGAGCTGACTGATCGACGTAGCTTGACGTACGTATCACGTACGTATCG

>PART_3 >CAGCTTCGGCGCGATTACTCTACGAGCACGACGCAGCTGTCGCTGTCTGGTCTACGCTAGCGCTACGACTATCGATCAGCGTCGTACTGACGTGACGCGCATCGACGTTCGGACGTCGTCGTCGTACGACGTCTACGATGC

The parts will be joined in the order PART_1–>PART_2–>PART_3.

To produce the CSV file that has all of the primers listed, from the command line, run python compute_primers.py. You will get a CSV file, named all_primers.csv, that will house the primers that you will need to order.

# Changelog

## Version 1.2

Added a class that converts one nucleotide sequence into another, using Gibson assembly primers.

Release History

Release History

This version
History Node

1.2

History Node

1.1

History Node

1.0

Download Files

Download Files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
FluGibson-1.2-py3-none-any.whl (24.8 kB) Copy SHA256 Checksum SHA256 py3 Wheel Aug 12, 2015
FluGibson-1.2.tar.gz (11.0 kB) Copy SHA256 Checksum SHA256 Source Aug 12, 2015

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting