This is a pre-production deployment of Warehouse, however changes made here WILL affect the production instance of PyPI.
Latest Version Dependencies status unknown Test status unknown Test coverage unknown
Project Description

# FluGibson

![Travis Status](https://travis-ci.org/ericmjl/flu-gibson.svg)

A tool for designing primers to clone influenza polymerase segments from viral cDNA.

# Installation

The installation requires the following packages:

  1. networkx
  2. biopython
  3. pandas (optional)
  4. matplotlib (optional)

From Github:

  1. Download this repository as a Zip file.
  2. Unzip the file.
  3. In your terminal, navigate to the FluGibson directory.
  4. Run command: python setup.py install

From PyPI:

  1. (if applicable) Switch to your proper Python environment.
  2. Run command: pip install FluGibson

Using Conda:

  1. (if applicable) Switch to your proper Python environment.
  2. Run command: conda install FluGibson

# Usage

## Scripted

One way to use FluGibson is to use the provided script in the /examples directory. Copy the script to your working directory.

Create the FASTA formatted files containing the DNA parts that you want to stitch together. For example, you would use the following FASTA definition to stitch the following 3 parts together:

>PART_1 >CATCTATCTCTCTACTGCGAGGCTATTCGACTGGCCGTTACTCGCCGGTACGTAGCTCGGTCTCGATCATCAGTACGTCTACGTGTCGTCGTACTTACACGGTCGCTCGGACTGACGTACGTCTACGTCGTCTGACTGA

>PART_2 >CTACTGTCTGCTGATGGTACGTACGTGAGTACGCGCAGCACAGACACTACTTACTCTCGCGCGAGAGCTATCTACGACTACGTACTCGTCGTACGAGCTGACTGATCGACGTAGCTTGACGTACGTATCACGTACGTATCG

>PART_3 >CAGCTTCGGCGCGATTACTCTACGAGCACGACGCAGCTGTCGCTGTCTGGTCTACGCTAGCGCTACGACTATCGATCAGCGTCGTACTGACGTGACGCGCATCGACGTTCGGACGTCGTCGTCGTACGACGTCTACGATGC

The parts will be joined in the order PART_1–>PART_2–>PART_3.

To produce the CSV file that has all of the primers listed, from the command line, run python compute_primers.py. You will get a CSV file, named all_primers.csv, that will house the primers that you will need to order.

# Changelog

## Version 1.2

Added a class that converts one nucleotide sequence into another, using Gibson assembly primers.

Release History

Release History

1.2

This version

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.1

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

Download Files

Download Files

TODO: Brief introduction on what you do with files - including link to relevant help section.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
FluGibson-1.2-py3-none-any.whl (24.8 kB) Copy SHA256 Checksum SHA256 py3 Wheel Aug 12, 2015
FluGibson-1.2.tar.gz (11.0 kB) Copy SHA256 Checksum SHA256 Source Aug 12, 2015

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting