Skip to main content

A Python package for designing influenza reverse genetics primers using the seamless cloning methods (e.g. Gibson assembly, CPEC assembly).

Project description

# FluGibson

![Travis Status](https://travis-ci.org/ericmjl/flu-gibson.svg)

A tool for designing primers to clone influenza polymerase segments from viral cDNA.

# Installation

The installation requires the following packages:

  1. networkx

  2. biopython

  3. pandas (optional)

  4. matplotlib (optional)

From Github:

  1. Download this repository as a Zip file.

  2. Unzip the file.

  3. In your terminal, navigate to the FluGibson directory.

  4. Run command: python setup.py install

From PyPI: (not ready yet)

  1. (if applicable) Switch to your proper Python environment.

  2. Run command: pip install FluGibson

Using Conda: (not ready yet)

  1. (if applicable) Switch to your proper Python environment.

  2. Run command: conda install FluGibson

# Usage

## Scripted

One way to use FluGibson is to use the provided script in the /examples directory. Copy the script to your working directory.

Create the FASTA formatted files containing the DNA parts that you want to stitch together. For example, you would use the following FASTA definition to stitch the following 3 parts together:

>PART_1 >CATCTATCTCTCTACTGCGAGGCTATTCGACTGGCCGTTACTCGCCGGTACGTAGCTCGGTCTCGATCATCAGTACGTCTACGTGTCGTCGTACTTACACGGTCGCTCGGACTGACGTACGTCTACGTCGTCTGACTGA

>PART_2 >CTACTGTCTGCTGATGGTACGTACGTGAGTACGCGCAGCACAGACACTACTTACTCTCGCGCGAGAGCTATCTACGACTACGTACTCGTCGTACGAGCTGACTGATCGACGTAGCTTGACGTACGTATCACGTACGTATCG

>PART_3 >CAGCTTCGGCGCGATTACTCTACGAGCACGACGCAGCTGTCGCTGTCTGGTCTACGCTAGCGCTACGACTATCGATCAGCGTCGTACTGACGTGACGCGCATCGACGTTCGGACGTCGTCGTCGTACGACGTCTACGATGC

The parts will be joined in the order PART_1–>PART_2–>PART_3.

To produce the CSV file that has all of the primers listed, from the command line, run python compute_primers.py. You will get a CSV file, named all_primers.csv, that will house the primers that you will need to order.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

FluGibson-1.1.tar.gz (4.0 kB view hashes)

Uploaded Source

Built Distribution

FluGibson-1.1-py3-none-any.whl (5.8 kB view hashes)

Uploaded Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page