Skip to main content

Open Source Transcription Initiation Rates

Project description

OSTIR (Open Source Translation Initiation Rates)

Status status

OSTIR is a Python package for predicting the rates at which ribosomes will bind to and initiate translation from different start codons in bacterial mRNAs. It uses the ViennaRNA Package to perform the necessary free energy calculations. The code builds on the last open source version of the RBS calculator.

OSTIR includes several improvements in usability. It supports multi-FASTA input with command line parameters or CSV input that can define parameters on a per-sequence basis. Additionally, OSTIR supports multi-threaded execution, accelerating the analysis of very large sequences.

Please see the OSTIR Wiki for full documentation

Quickstart

Installation

install with bioconda

OSTIR is a Python module and associated command line script. We recommend installing OSTIR using Bioconda on Linux or macOS. This will automatically install OSTIR and all of its dependencies, including ViennaRNA and the required Python modules.

From Bioconda (recommended; Linux, macOS):

  • Run conda install -c bioconda ostir

From Pip (for experts; Linux, macOS, Windows):

  • Download and install ViennaRNA, following the instructions here.
  • Run pip install ostir

For information on installing for development see the Wiki Documentation.

Command Line Usage

Print OSTIR help:

ostir -h

Run OSTIR on a sequence provided at the command line and print output to the console:

ostir -i TTCTAGATGAGAATAAGGTTATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGT

Run OSTIR on all sequences provided in a FASTA file and print output to a CSV file:

ostir -i input.fasta -o output.csv

More options and examples are described in the Wiki Documentation.

Python Module Usage

Run OSTIR on a sequence inside of a Python script:

from ostir.ostir import run_ostir

seq = "ACUUCUAAUUUAUUCUAUUUAUUCGCGGAUAUGCAUAGGAGUGCUUCGAUGUCAU"
results = run_ostir(seq, name="my_sequence", threads=8)
print(results)

More options and examples are described in the Wiki Documentation.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

OSTIR-1.0.6.tar.gz (158.4 kB view hashes)

Uploaded Source

Built Distribution

OSTIR-1.0.6-py3-none-any.whl (96.8 kB view hashes)

Uploaded Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page