Skip to main content

find antimcirobial resistance genes on genomes

Project description

ResBlaster

PYPI Static Badge

 ____           ____  _           _
|  _ \ ___  ___| __ )| | __ _ ___| |_ ___ _ __
| |_) / _ \/ __|  _ \| |/ _` / __| __/ _ \ '__|
|  _ <  __/\__ \ |_) | | (_| \__ \ ||  __/ |
|_| \_\___||___/____/|_|\__,_|___/\__\___|_|

Installation

pip3 install ResBlaster

Dependency

  • BLAST+ >2.7.0

  • cvmblaster (v0.4.1)

you should add BLAST in your PATH

Blast installation

Windows

Following this tutorial: Add blast into your windows PATH

Linux/Mac

The easyest way to install blast is:

conda install -c bioconda blast

Usage

1. Initialize reference database

After finish installation, you should first initialize the reference database using following command

ResBlaster init
Usage: ResBlaster -i <genome assemble directory> -db <reference database> -o <output_directory>

Author: Qingpo Cui(SZQ Lab, China Agricultural University)

optional arguments:
  -h, --help            show this help message and exit
  -i I                  <input_path>: the PATH to the directory of assembled genome files
  -o O                  <output_directory>: output PATH
  -db DB                <database>: resfinder or others, You colud check database list using -list parameter
  -minid MINID          <minimum threshold of identity>, default=90
  -mincov MINCOV        <minimum threshold of coverage>, default=60
  -t T                  <number of threads>: default=8
  -store_arg_seq        <save the nucleotide and amino acid sequence of find genes on genome>
  -v, --version         <display version>
  -updatedb UPDATEDB    <add input fasta to BLAST database>

ResBlaster subcommand:
  {show_db,init,updatedb}
    show_db             <show the list of all available database>
    init                <initialize the reference database>
    updatedb            <add custome database, use ResBlaster updatedb -h for help>

2. Show available database

ResBlaster show_db
DB_name No. of seqs Update_date
ESBL 1101 2024-10-09
LGI 1255 2024-07-31
bacmet1 578 2024-10-09
bacmet2_exp 753 2024-10-09
bacmet2_pred 155512 2024-10-09
lmo 20195 2024-10-09
ncbi 6146 2024-10-09
resfinder 3154 2024-10-09
rpoB 1 2024-10-09
ssuis_vf 111 2024-10-09
vf_hps 49 2024-10-09
vfdb_core 4329 2024-10-09
vfdb_full 32164 2024-10-09
vibrio_vf 5 2024-08-25

2. Making your own database

Let's say you want to make your own database called owndb. All you need is a FASTA file of nucleotide sequences, say owndb.fsa(note: the fasta file must end with .fsa). Ideally the sequence IDs would have the format >GENE___ID___ACC___CATEGORY where GENE is the name of GENE, ID is the allele ID of GENE, ACC is an accession number of the sequence source, CATEGORY is the CATEGORY of this GENE belongs to.

Your final owndb.fsa should like this:

>blaOXA-62___1___AY423074___Beta-lactam
ATGAATACGATAATCTCTCGCCGGTGGCGTGCCGGCCTGTGGCGGCGGCTGGTCGGCGCG
GTCGTCTTGCCCGCAACGCTCGCCGCCACCCCTGCGGCCTATGCGGCCGACGTGCCGAAA
GCCGCGTTGGGGCGCATCACCGAGCGCGCCGACTGGGGCAAGCTGTTCGCCGCGGAGGGC
GTGAAGGGCACGATCGTGGTGCTCGACGCACGCACGCAAACCTATCAGGCCTACGACGCC
GCACGTGCCGAGAAGCGCATGTCGCCGGCGTCGACCTACAAGATATTCAACAGCCTGCTG
GCGCTCGACTCCGGGGCGCTGGACAACGAACGCGCGATCATTCCCTGGGATGGCAAGCCG
CGACGCATCAAGAACTGGAACGCGGCGATGGACCTGAGGACCGCGTTTCGCGTGTCATGC
CTGCCCTGCTATCAGGTCGTCTCGCACAAGATCGGGCGCCGGTACGCGCAGGCGAAGCTG
AACGAGGTCGGGTATGGCAACCGCACCATTGGCGGCGCGCCGGACGCCTATTGGGTCGAC
GACAGTCTGCAGATTTCGGCGCGTGAGCAGGTGGACTTCGTGCAGCGTCTCGCGCGTGGC
ACGTTGCCGTTCTCTGCGCGCTCGCAGGACATCGTGCGCCAGATGTCGATCGTCGAAGCC
ACGCCGGACTATGTGCTTCACGGCAAGACGGGTTGGTTCGTCGACAAGAAGCCCGATATC
GGCTGGTGGGTAGGGTGGATCGAGCGCGACGGCAACATCACCAGCGTCGCGATCAACATC
GACATGCTGTCGGAGGCGGACGCCCCGAAACGGGCACGCATCGTGAAGGCGGTGCTGAAG
GACCTGAAGCTGATCTGA

Run following command will add owndb.fsa to blast database

ResBlaster -updatedb owndb.fsa

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

ResBlaster-0.4.5.tar.gz (19.1 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

ResBlaster-0.4.5-py3-none-any.whl (20.6 MB view details)

Uploaded Python 3

File details

Details for the file ResBlaster-0.4.5.tar.gz.

File metadata

  • Download URL: ResBlaster-0.4.5.tar.gz
  • Upload date:
  • Size: 19.1 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.8.0 pkginfo/1.8.2 readme-renderer/32.0 requests/2.32.3 requests-toolbelt/0.9.1 urllib3/1.26.7 tqdm/4.66.5 importlib-metadata/4.10.1 keyring/23.5.0 rfc3986/2.0.0 colorama/0.4.6 CPython/3.9.8

File hashes

Hashes for ResBlaster-0.4.5.tar.gz
Algorithm Hash digest
SHA256 9d07129d169a295e73f0516a00253213953b92b9b7ea8f8ea9d5c66fde99504f
MD5 2f33161c4904c68dd817db2792052a68
BLAKE2b-256 2b9f20e428edafdfadf5e3e68486dcea5b23e3ea9ac039d394ef747b949f1e84

See more details on using hashes here.

File details

Details for the file ResBlaster-0.4.5-py3-none-any.whl.

File metadata

  • Download URL: ResBlaster-0.4.5-py3-none-any.whl
  • Upload date:
  • Size: 20.6 MB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.8.0 pkginfo/1.8.2 readme-renderer/32.0 requests/2.32.3 requests-toolbelt/0.9.1 urllib3/1.26.7 tqdm/4.66.5 importlib-metadata/4.10.1 keyring/23.5.0 rfc3986/2.0.0 colorama/0.4.6 CPython/3.9.8

File hashes

Hashes for ResBlaster-0.4.5-py3-none-any.whl
Algorithm Hash digest
SHA256 f4636ad2c872073a7f12e010eed94379bb75d4a777d09db78192ead438d5acd7
MD5 fb994f81e6e14099ea374f6631530a01
BLAKE2b-256 83d82d02a4b697fd60123c34d42e99096c29486a8ea9b440ae0d2e49f422309e

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page