Skip to main content

Metagenomic binning with semi-supervised siamese neural network

Project description

SemiBin: Semi-supervised Metagenomic Binning Using Siamese Neural Networks

Command tool for metagenomic binning with semi-supervised deep learning using information from reference genomes in Linux and MacOS.

BioConda Install Test Status Documentation Status License: MIT

CONTACT US: Please use GitHub issues for bug reports and the SemiBin users mailing-list for more open-ended discussions or questions.

If you use this software in a publication please cite:

Pan, S., Zhu, C., Zhao, XM. et al. A deep siamese neural network improves metagenome-assembled genomes in microbiome datasets across different environments. Nat Commun 13, 2326 (2022). https://doi.org/10.1038/s41467-022-29843-y

Basic usage of SemiBin

A tutorial of running SemiBin from scrath can be found here SemiBin tutorial.

Installation:

conda create -n SemiBin
conda activate SemiBin
conda install -c conda-forge -c bioconda semibin

The inputs to the SemiBin are contigs (assembled from the reads) and BAM files (reads mapping to the contigs). In the docs you can see how to generate the inputs starting with a metagenome.

Running with single-sample binning (for example: human gut samples):

SemiBin single_easy_bin -i contig.fa -b *.bam -o output --environment human_gut

Running with multi-sample binning:

SemiBin multi_easy_bin -i contig_whole.fa -b *.bam -o output -s :

The output includes the bins in the output_recluster_bins directory (including the bin.*.fa and recluster.*.fa).

Please find more options and details below and read the docs.

Advanced Installation

SemiBin runs on Python 3.7-3.9.

Bioconda

The simplest mode is shown above. However, if you want to use SemiBin with GPU (which is faster if you have one available), you need to install PyTorch with GPU support:

conda create -n SemiBin
conda activate SemiBin
conda install -c conda-forge -c bioconda semibin
conda install -c pytorch-lts pytorch torchvision torchaudio cudatoolkit=10.2 -c pytorch-lts

MacOS note: you can only install the CPU version of PyTorch in MacOS with conda and you need to install from source to take advantage of a GPU (see #72). For more information on how to install PyTorch, see their documentation.

Source

You will need the following dependencies:

The easiest way to install the dependencies is with conda:

conda install -c conda-forge -c bioconda mmseqs2=13.45111 # (for GTDB support)
conda install -c bioconda bedtools hmmer prodigal
conda install -c bioconda fraggenescan

Once the dependencies are installed, you can install SemiBin by running:

python setup.py install

Examples of binning

NOTE: The SemiBin API is a work-in-progress. The examples refer to version 0.6, but this may change in the near future (after the release of version 1.0, we expect to freeze the API for at least 5 years). We are very happy to hear any feedback on API design, though.

SemiBin runs on single-sample, co-assembly and multi-sample binning. Here we show the simple modes as an example. For the details and examples of every SemiBin subcommand, please read the docs.

Easy single/co-assembly binning mode

Single sample and co-assembly are handled the same way by SemiBin.

You will need the following inputs:

  1. A contig file (contig.fa in the example below)
  2. BAM file(s) from mapping short reads to the contigs (mapped_reads.bam in the example below)

The single_easy_bin command can be used to produce results in a single step.

For example:

SemiBin \
    single_easy_bin \
    --input-fasta contig.fa \
    --input-bam mapped_reads.bam \
    --environment human_gut \
    --output output

Alternatively, you can train a new model for that sample, by not passing in the --environment flag:

SemiBin \
    single_easy_bin \
    --input-fasta contig.fa \
    --input-bam mapped_reads.bam \
    --output output

The following environments are supported:

  • human_gut
  • dog_gut
  • ocean
  • soil
  • cat_gut
  • human_oral
  • mouse_gut
  • pig_gut
  • built_environment
  • wastewater
  • global

The global environment can be used if none of the others is appropriate. Note that training a new model can take a lot of time and disk space. Some patience will be required. If you have a lot of samples from the same environment, you can also train a new model from them and reuse it.

Easy multi-samples binning mode

The multi_easy_bin command can be used in multi-samples binning mode:

You will need the following inputs:

  1. A combined contig file
  2. BAM files from mapping

For every contig, format of the name is <sample_name>:<contig_name>, where : is the default separator (it can be changed with the --separator argument). NOTE: Make sure the sample names are unique and the separator does not introduce confusion when splitting. For example:

>S1:Contig_1
AGATAATAAAGATAATAATA
>S1:Contig_2
CGAATTTATCTCAAGAACAAGAAAA
>S1:Contig_3
AAAAAGAGAAAATTCAGAATTAGCCAATAAAATA
>S2:Contig_1
AATGATATAATACTTAATA
>S2:Contig_2
AAAATATTAAAGAAATAATGAAAGAAA
>S3:Contig_1
ATAAAGACGATAAAATAATAAAAGCCAAATCCGACAAAGAAAGAACGG
>S3:Contig_2
AATATTTTAGAGAAAGACATAAACAATAAGAAAAGTATT
>S3:Contig_3
CAAATACGAATGATTCTTTATTAGATTATCTTAATAAGAATATC

You can use this to get the combined contig:

SemiBin concatenate_fasta -i contig*.fa -o output

You can get the results with one line of code.

SemiBin multi_easy_bin -i concatenated.fa -b *.bam -o output

Output

The output folder will contain:

  1. Datasets used for training and clustering
  2. Saved semi-supervised deep learning model
  3. Output bins
  4. Some intermediate files

By default, reconstructed bins are in output_recluster_bins directory.

For more details about the output, read the docs.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

SemiBin-1.0.0.tar.gz (34.7 MB view hashes)

Uploaded Source

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page