abritamr 1.2.0

Running AMRFinderPlus for MDU

Taming the AMR beast

abriTAMR is an AMR gene/variant detection pipeline that runs AMRFinderPlus on bacteiral genome assemblues, categorises the variants into reportable/not-reportable, and sorts into clinical drug classes.

abriTAMR is accredited by NATA for use in identifying the presence of reportable AMR genes the MDU PHL in Victoria, Australia.

Installation

% conda create -n abritamr -c bioconda abritamr
% conda activate abritamr
% abritamr --version

Quick start

% abritamr run -c genome.fasta

% ls abritamr
abritamr.log         summary_partials.txt
amrfinder.out        summary_virulence.txt
summary_matches.txt  update_abritamr_db.log

% cat abritamr/abritamr.txt
Isolate	Methicillin	Tetracycline	Tigecycline	Beta-lactam	Penicillin resistance (Staphylococcus aureus)
abritamr	mecA,mecR1^	tet(38)*	mepA*	blaI*,blaR1*	blaZ

Input

The -c option is used for input, and can accept 2 types of files:

1. a single FASTA file, usually a genome assembly:

>contug001
AGTCTCGATATGCTATAGGCTTATATATAT
ATGCTATAGGCTTATATATATTTATATCTT
>contig002
CGATATGCTATAGGCTTATATATATTTATA
...

2. a TSV file for multiple FASTA files:

ID1 <tab> /path/to/assembly1.fasta
ID2 <tab> /path/to/second/file.fna
...

Running

abritamr run --help


optional arguments:
  -h, --help            show this help message and exit
  --contigs CONTIGS, -c CONTIGS
                        Tab-delimited file with sample ID as column 1 and path to assemblies as column 2 OR path to a contig
                        file (used if only doing a single sample - should provide value for -pfx). (default: )
  --prefix PREFIX, -px PREFIX
                        If running on a single sample, please provide a prefix for output directory (default: abritamr)
  --jobs JOBS, -j JOBS  Number of AMR finder jobs to run in parallel. (default: 16)
  --identity IDENTITY, -i IDENTITY
                        Set the minimum identity of matches with amrfinder (0 - 1.0). Defaults to amrfinder preset, which is 0.9
                        unless a curated threshold is present for the gene. (default: )
  --amrfinder_db AMRFINDER_DB, -d AMRFINDER_DB
                        Path to amrfinder DB to use (default:
                        /<path_to_installation>/abritamr/abritamr/db/amrfinderplus/data/2021-09-30.1)
  --species {Neisseria,Clostridioides_difficile,Acinetobacter_baumannii,Campylobacter,Enterococcus_faecalis,Enterococcus_faecium,Escherichia,Klebsiella,Salmonella,Staphylococcus_aureus,Staphylococcus_pseudintermedius,Streptococcus_agalactiae,Streptococcus_pneumoniae,Streptococcus_pyogenes}, -sp {Neisseria,Clostridioides_difficile,Acinetobacter_baumannii,Campylobacter,Enterococcus_faecalis,Enterococcus_faecium,Escherichia,Klebsiella,Salmonella,Staphylococcus_aureus,Staphylococcus_pseudintermedius,Streptococcus_agalactiae,Streptococcus_pneumoniae,Streptococcus_pyogenes}
                        Set if you would like to use point mutations, please provide a valid species. (default: )

You can also run abriTAMR in report mode, this will output a spreadsheet which is based on reportable/not-reportable requirements in Victoria. You will need to supply a quality control file (comma separated) (-q), with the following columns:

• ISOLATE
• SPECIES_EXP (the species that was expected)
• SPECIES_OBS (the species that was observed during the quality control analysis)
• TEST_QC (PASS or FAIL)

--sop refers to the type of collation and reporting pipeline

• general
  • standard reporting structure for aquired genes, output as reportable and non-reportable
• plus
  • Inferred AST based on validation undertaken at MDU

abritamr report --help

optional arguments:
  -h, --help            show this help message and exit
  --qc QC, -q QC        Name of checked MDU QC file. (default: )
  --runid RUNID, -r RUNID
                        MDU RunID (default: Run ID)
  --matches MATCHES, -m MATCHES
                        Path to matches, concatentated output of abritamr (default: summary_matches.txt)
  --partials PARTIALS, -p PARTIALS
                        Path to partial matches, concatentated output of abritamr (default: summary_partials.txt)
  --sop {general,plus}  The MDU pipeline for reporting results. (default: general)

Output

abritAMR run

Outputs 4 summary files and retains the raw AMRFinderPlus output for each sequence input.

1. amrfinder.out raw output from AMRFinder plus (per sequence). For more information please see AMRFinderPlus help here

2. summary_matches.txt

• Tab-delimited file, with a row per sequence, and columns representing functional drug classes

• Only genes recovered from sequence which have >90% coverage of the gene reported and greater than the desired identity threshold (default 90%).

  I. Genes annotated with * indicate >90% coverage and > identity threshold < 100% identity.

  II. No further annotation indicates that the gene recovered exhibits 100% coverage and 100% identity to a gene in the gene catalog.

  III. Point mutations detected (if --species supplied) will also be present in this file in the form of gene_AAchange.

3. summary_partials.txt

• Tab-delimited file, with a row per sequence, and columns representing functional drug classes
• Genes recovered from sequence which have >50% but <90% coverage of the gene reported and greater than the desired identity threshold (default 90%).

4. summary_virulence.txt

• Tab-delimited file, with a row per sequence, and columns representing AMRFinderPlus virulence gene classification

• Genes recovered from sequence which have >50% coverage of the gene reported and greater than the desired identity threshold (default 90%).

  • Genes recovered with >50% but <90% coverage of a gene in the gene catalog will be annotated with ^.
  • Genes annotated with * indicate >90% coverage and > identity threshold < 100% identity.

4. abritamr.txt

• Tab-delimited file, combining summary_matches.txt, summary_partials.txt, summary_virulence.txt with a row per sequence, and columns representing AMRFinderPlus virulence gene classification and/or functional drug classes.

• Genes recovered from sequence which have >50% coverage of the gene reported and greater than the desired identity threshold (default 90%).

  • Genes recovered with >50% but <90% coverage of a gene in the gene catalog will be annotated with ^.
  • Genes annotated with * indicate >90% coverage and > identity threshold < 100% identity.

abritamr report

will output spreadsheets general_runid.xlsx (NATA accredited) or plus_runid.xlsx (validated - not yet accredited) depending upon the sop chosen.

• general_rundid.xlsx has two tabs, one for matches and one for partials (corresponding to genes reported in the summary_matches.txt and summary_partials.txt). Each tab has 7 columns

Column	Interpretation
MDU sample ID	Sample ID
Item code	suffix (MDU specific)
Resistance genes (alleles) detected	genes detected that are reportable (based on species and drug classification)
Resistance genes (alleles) det (non-rpt)	other genes detected that are not not reportable for the species detected.
Species_obs	Species observed (supplied in input file)
Species_exp	Species expected (supplied in input file)
db_version	Version of the AMRFinderPlus DB used

• plus_runid.xlsx output is a spreadsheet with the different drug resistance mechanims and the corresponding interpretation (based on validation of genotype and phenotype) for drug-classes relevant to reporting of anti-microbial resistance in Salmonella enterica (other species will be added as validation of genotype vs phenotype is performed).

• Ampicillin

• Cefotaxime (ESBL)

• Cefotaxime (AmpC)

• Tetracycline

• Gentamicin

• Kanamycin

• Streptomycin

• Sulfathiazole

• Trimethoprim

• Trim-Sulpha

• Chloramphenicol

• Ciprofloxacin

• Meropenem

• Azithromycin

• Aminoglycosides (RMT)

• Colistin

References

• AMR FInder Plus
• Abricate

Feedback

File questions, bugs, or ideas on the Issues page

License

GPLv3

Citation

Sherry, N.L., Horan, K.A., ... , Seemann, T. An ISO-certified genomics workflow for identification and surveillance of antimicrobial resistance Nat Commun 14;60 (2023). DOI:10.1038/s41467-022-35713-4 PMID:36599823

Authors

• Kristy Horan
• Torsten Seemann
• Norelle Sherry
• CHarlie Higgs (logo design)