Skip to main content

This is a library to evaluate an aminoacid sequence and determine an amphipathic index for each alpha helix or beta sheet.

Project description


License Downloads Build Status Coverage Status Code Health PyPI version

This is a library to evaluate an aminoacid sequence and determine an amphipathic index for each alpha helix or beta sheet.


If you want to use this library on any GNU/Linux or OSX system you just need to execute:

$ pip install amphipathic

If you want to collaborate with this library, you should download the github repository and execute:

$ make deploy


To test all the project you should use the command:

$ make test


This library can analyze an aminoacid sequence and gives a list of secondary structures with the respective index:

import amphipathic
resume = amphipathic.index('NLYIQWLKDGGPSSGRPPPS') 
print resume

And the result should be:

    {'end': 2,
     'begin': 0,
     'type': u'c',
     'seq': 'nl',
     'amphipathic': {'index': 7.572935321054872e-05, 'mean': 2.6}},
    {'end': 5,
     'begin': 2,
     'type': u'e',
     'seq': 'yiq',
     'amphipathic': {'index': 1.4312912272216411, 'mean': 1.7299999999999998}},
    {'end': 18,
     'begin': 5,
     'type': u'c',
     'seq': 'wlkdggpssgrpp',
     'amphipathic': {'index': 0.002511560979331271, 'mean': -0.43}},
    {'end': 20,
     'begin': 18,
     'type': u'e',
     'seq': 'ps',
     'amphipathic': {'index': 1.6242872515167746, 'mean': -1.34}}

It also accept a nucleotide sequence to perform the same analysis:

import amphipathic
resume = amphipathic.index('cgcgtccttggagcaatgcagttcaagaccaagaatcgaattgaacctgt') 
print resume

And the output:

    {'end': 12,
     'begin': 0,
     'type': u'c',
     'seq': 'rvlgamqfktkn',
     'amphipathic': {'index': 0.007560225956225585, 'mean': 0.7825000000000001}},
    {'end': 15,
     'begin': 12,
     'type': u'e',
     'seq': 'rie',
     'amphipathic': {'index': 1.6297837670649824, 'mean': 1.4599999999999997}},
    {'end': 16,
     'begin': 15,
     'type': u'c',
     'seq': 'p',
     'amphipathic': {'index': 0.0, 'mean': -2.23}}

Last, it also accept a polyprotein sequence. When working with aminoacid it detect the '*' character as a stop signal:

import amphipathic
resume = amphipathic.index('NLYIQWLKDG*GPSSGRPPPS') 
print resume


If you want to develope with us or have questions about this library, please file an issue in this repository so some of the project managers can get back to you. Please check the existing (and closed) issues to make sure your issue hasn't already been addressed.

Project details

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Files for amphipathic, version 0.3.4
Filename, size File type Python version Upload date Hashes
Filename, size amphipathic-0.3.4-py3-none-any.whl (6.7 kB) File type Wheel Python version py3 Upload date Hashes View
Filename, size amphipathic-0.3.4.tar.gz (7.9 kB) File type Source Python version None Upload date Hashes View

Supported by

Pingdom Pingdom Monitoring Google Google Object Storage and Download Analytics Sentry Sentry Error logging AWS AWS Cloud computing DataDog DataDog Monitoring Fastly Fastly CDN DigiCert DigiCert EV certificate StatusPage StatusPage Status page