Skip to main content
Help us improve Python packaging – donate today!

This is a library to evaluate an aminoacid sequence and determine an amphipathic index for each alpha helix or beta sheet.

Project Description


License Downloads Build Status Coverage Status Code Health PyPI version Stories in Ready

This is a library to evaluate an aminoacid sequence and determine an amphipathic index for each alpha helix or beta sheet.


If you want to use this library on any GNU/Linux or OSX system you just need to execute:

$ pip install noaaclass

If you want to collaborate with this library, you should download the github repository and execute:

$ make deploy


To test all the project you should use the command:

$ make test


This library can analyze an aminoacid sequence and gives a list of secondary structures with the respective index:

import amphipathic
resume = amphipathic.index('NLYIQWLKDGGPSSGRPPPS')
print resume

And the result should be:

    {'end': 2,
     'begin': 0,
     'type': u'c',
     'seq': 'nl',
     'amphipathic': {'index': 7.572935321054872e-05, 'mean': 2.6}},
    {'end': 5,
     'begin': 2,
     'type': u'e',
     'seq': 'yiq',
     'amphipathic': {'index': 1.4312912272216411, 'mean': 1.7299999999999998}},
    {'end': 18,
     'begin': 5,
     'type': u'c',
     'seq': 'wlkdggpssgrpp',
     'amphipathic': {'index': 0.002511560979331271, 'mean': -0.43}},
    {'end': 20,
     'begin': 18,
     'type': u'e',
     'seq': 'ps',
     'amphipathic': {'index': 1.6242872515167746, 'mean': -1.34}}

It also accept a nucleotide sequence to perform the same analysis:

import amphipathic
resume = amphipathic.index('cgcgtccttggagcaatgcagttcaagaccaagaatcgaattgaacctgt')
print resume

And the output:

    {'end': 12,
     'begin': 0,
     'type': u'c',
     'seq': 'rvlgamqfktkn',
     'amphipathic': {'index': 0.007560225956225585, 'mean': 0.7825000000000001}},
    {'end': 15,
     'begin': 12,
     'type': u'e',
     'seq': 'rie',
     'amphipathic': {'index': 1.6297837670649824, 'mean': 1.4599999999999997}},
    {'end': 16,
     'begin': 15,
     'type': u'c',
     'seq': 'p',
     'amphipathic': {'index': 0.0, 'mean': -2.23}}


If you want to develope with us or have questions about this library, please file an issue in this repository so some of the project managers can get back to you. Please check the existing (and closed) issues to make sure your issue hasn’t already been addressed.

Release history Release notifications

This version
History Node


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Filename, size & hash SHA256 hash help File type Python version Upload date
amphipathic-0.0.0.tar.gz (8.2 kB) Copy SHA256 hash SHA256 Source None Jun 21, 2015

Supported by

Elastic Elastic Search Pingdom Pingdom Monitoring Google Google BigQuery Sentry Sentry Error logging CloudAMQP CloudAMQP RabbitMQ AWS AWS Cloud computing Fastly Fastly CDN DigiCert DigiCert EV certificate StatusPage StatusPage Status page