Skip to main content

This is a library to evaluate an aminoacid sequence and determine an amphipathic index for each alpha helix or beta sheet.

Project description

amphipathic
===========

[![License](https://img.shields.io/pypi/l/amphipathic.svg)](https://raw.githubusercontent.com/ecolell/amphipathic/master/LICENSE) [![Downloads](https://img.shields.io/pypi/dm/amphipathic.svg)](https://pypi.python.org/pypi/amphipathic/) [![Build Status](https://travis-ci.org/ecolell/amphipathic.svg?branch=master)](https://travis-ci.org/ecolell/amphipathic) [![Coverage Status](https://coveralls.io/repos/ecolell/amphipathic/badge.png)](https://coveralls.io/r/ecolell/amphipathic) [![Code Health](https://landscape.io/github/ecolell/amphipathic/master/landscape.png)](https://landscape.io/github/ecolell/amphipathic/master) [![PyPI version](https://badge.fury.io/py/amphipathic.svg)](http://badge.fury.io/py/amphipathic)

This is a library to evaluate an aminoacid sequence and determine an amphipathic index for each alpha helix or beta sheet.

Requirements
------------

If you want to use this library on any GNU/Linux or OSX system you just need to execute:

$ pip install amphipathic


If you want to collaborate with this library, you should download the [github repository](https://github.com/ecolell/amphipathic) and execute:

$ make deploy


Testing
-------

To test all the project you should use the command:

$ make test


Example
-------

This library can analyze an aminoacid sequence and gives a list of secondary structures with the respective index:

```python
import amphipathic
resume = amphipathic.index('NLYIQWLKDGGPSSGRPPPS')
print resume
```

And the result should be:

```python
[[
{'end': 2,
'begin': 0,
'type': u'c',
'seq': 'nl',
'amphipathic': {'index': 7.572935321054872e-05, 'mean': 2.6}},
{'end': 5,
'begin': 2,
'type': u'e',
'seq': 'yiq',
'amphipathic': {'index': 1.4312912272216411, 'mean': 1.7299999999999998}},
{'end': 18,
'begin': 5,
'type': u'c',
'seq': 'wlkdggpssgrpp',
'amphipathic': {'index': 0.002511560979331271, 'mean': -0.43}},
{'end': 20,
'begin': 18,
'type': u'e',
'seq': 'ps',
'amphipathic': {'index': 1.6242872515167746, 'mean': -1.34}}
]]
```

It also accept a nucleotide sequence to perform the same analysis:

```python
import amphipathic
resume = amphipathic.index('cgcgtccttggagcaatgcagttcaagaccaagaatcgaattgaacctgt')
print resume
```

And the output:

```python
[[
{'end': 12,
'begin': 0,
'type': u'c',
'seq': 'rvlgamqfktkn',
'amphipathic': {'index': 0.007560225956225585, 'mean': 0.7825000000000001}},
{'end': 15,
'begin': 12,
'type': u'e',
'seq': 'rie',
'amphipathic': {'index': 1.6297837670649824, 'mean': 1.4599999999999997}},
{'end': 16,
'begin': 15,
'type': u'c',
'seq': 'p',
'amphipathic': {'index': 0.0, 'mean': -2.23}}
]]
```

Last, it also accept a polyprotein sequence. When working with aminoacid it detect the '*' character as a stop signal:

```python
import amphipathic
resume = amphipathic.index('NLYIQWLKDG*GPSSGRPPPS')
print resume
```


Questions?
----------

If you want to develope with us or have questions about this library, please file an issue in this repository so some of the project managers can get back to you. Please check the existing (and closed) issues to make sure your issue hasn't already been addressed.


Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

amphipathic-0.2.3.tar.gz (7.2 kB view hashes)

Uploaded Source

Built Distribution

amphipathic-0.2.3-py3-none-any.whl (5.8 kB view hashes)

Uploaded Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page