trim adapters from high-throughput sequencing reads
Project description
![https://travis-ci.org/jdidion/atropos](https://travis-ci.org/jdidion/atropos.svg?branch=master) ![https://pypi.python.org/pypi/atropos](https://img.shields.io/pypi/v/atropos.svg?branch=master)
# Atropos
Atropos is tool for specific, sensitive, and speedy trimming of NGS reads. It is a fork of the venerable Cutadapt read trimmer (https://github.com/marcelm/cutadapt, [DOI:10.14806/ej.17.1.200](http://dx.doi.org/10.14806/ej.17.1.200)), with the primary improvements being:
Multi-threading support that has been optimized for different parallel computing environments.
Options for trimming specific types of data (miRNA, bisulfite).
The ability (currently limited) to merge overlapping reads.
The ability to write the summary report and log messages to separate files.
The ability to write interleaved FASTQ output.
A progress bar, and other minor usability enhancements.
## Dependencies
Python 3.3+ (python 2.x is NOT supported)
Cython 0.24+ (pip install Cython)
progressbar or tqdm (optional, if you want progressbar support)
## Installation
pip install atropos
## Usage
Atropos is fully backward-compatible with cutadapt. If you currently use cutadapt, you can simply install Atropos and then substitute the executable name in your command line. For example:
`{r} atropos -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTTA -o trimmed.fq.gz reads.fq.gz `
To take advantage of multi-threading, set the –threads option:
` {r} atropos --threads 8 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTTA -o trimmed.fq.gz reads.fq.gz `
See the [Documentation](https://atropos.readthedocs.org/) for more complete usage information.
## Links
[Documentation](https://atropos.readthedocs.org/)
[Source code](https://github.com/jdidion/atropos/)
[Report an issue](https://github.com/jdidion/atropos/issues)
## Planned enhancments
Implement an autodetect option for adapters similar to TrimGalore: read the first 1M reads, search for common adapters, and pick the one that appears most frequently.
## Citations
The citation for the original Cutadapt paper is:
> Marcel Martin. “Cutadapt removes adapter sequences from high-throughput sequencing reads.” EMBnet.Journal, 17(1):10-12, May 2011. http://dx.doi.org/10.14806/ej.17.1.200
A manuscript for Atropos is currently in preparation. For now, you can cite it as:
> John P Didion. “Atropos.” 2016. https://github.com/jdidion/atropos
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
File details
Details for the file atropos-1.0.1.tar.gz
.
File metadata
- Download URL: atropos-1.0.1.tar.gz
- Upload date:
- Size: 265.3 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | 04180c59cdbe5c056b9c5a50c9baa66c3da4a10684727d35944bb3ec17128d2c |
|
MD5 | 3f03842a7a23ab74d0cedf57dde0885a |
|
BLAKE2b-256 | 9e47e020f0c325cdf857b88f1ee11ea03070b5ccebc2e4e737250f165c650a25 |