Pure Python, OS-agnostic Binary Alignment Map (BAM) random access and parsing tool
Project description
| |PyPI version| |License|
| # BAMnostic a *pure Python*, **OS-agnositic** Binary Alignment Map
(BAM) file parser and random access tool. \*\*\* ## Installation There
are 3 methods of installation available (choose one): Through the
Python Package Index (`PyPI <https://pypi.org/>`__)
.. code:: bash
pip install bamnostic
# or, if you don't have superuser access
pip install --user bamnostic
2
.. code:: bash
# again, use --user if you don't have superuser access
pip install -e git+https://github.com/betteridiot/bamnostic.git
# or, if you don't have superuser access
pip install --user -e git+https://github.com/betteridiot/bamnostic.git
3
.. code:: bash
git clone https://github.com/betteridiot/bamnostic.git
cd bamnostic
pip install -e .
# or, if you don't have superuser access
pip install --user -e .
Quickstart
----------
--------------
Bamnostic is meant to be a reduced drop-in replacement for
`pysam <https://github.com/pysam-developers/pysam>`__. As such it has
much the same API as ``pysam`` with regard to BAM-related operations.
**Note**: the ``pileup()`` method is not supported at this time. ###
Importing
.. code:: python
import bamnostic as bs
Loading your BAM file
~~~~~~~~~~~~~~~~~~~~~
Bamnostic comes with an example BAM (and respective BAI) file just to
play around with the output. Note, however, that the example BAM file
does not contain many reference contigs. Therefore, random access is
limited. This example file is made availble through
``bamnostic.example_bam``, which is a just a string path to the BAM file
within the package.
.. code:: python
bam = bs.AlignmentFile(bs.example_path, 'rb')
Get the header
~~~~~~~~~~~~~~
**Note**: this will print out the SAM header. If the SAM header is not
in the BAM file, it will print out the dictionary representation of the
BAM header. It is a dictionary of refID keys with contig names and
length tuple values.
.. code:: python
bam.header
>>> {0: ('chr1', 1575), 1: ('chr2', 1584)}
Data validation through ``head()``
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
.. code:: python
bam.head(n=2)
>>>EAS56_57:6:190:289:82 69 chr1 99 0 0 99 0 CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA MF:C:192
EAS56_57:6:190:289:82 137 chr1 99 73 35M 0 99 0 AGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCAC
Getting the first read
~~~~~~~~~~~~~~~~~~~~~~
.. code:: python
first_read = next(bam)
print(first_read)
>>> EAS56_57:6:190:289:82 69 chr1 99 0 0 99 0 CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA MF:C:192
Exploring the read
~~~~~~~~~~~~~~~~~~
.. code:: python
# read name
print(first_read.read_name)
>>> EAS56_57:6:190:289:82
# 0-based position
print(first_read.pos)
>>> 99
# nucleotide sequence
print(first_read.seq)
>>> CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA
# Read FLAG
print(first_read.flag)
>>> 69
# decoded FLAG
bs.utils.flag_decode(first_read.flag)
>>> [(1, 'read paired'), (4, 'read unmapped'), (64, 'first in pair')]
Random Access
~~~~~~~~~~~~~
.. code:: python
for i, read in enumerate(bam.fetch('chr2', 1, 100)):
if i >= 3:
break
print(read)
>>> B7_591:8:4:841:340 73 chr2 0 99 36M -1 -1 0 TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAA MF:C:18 Aq:C:77 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
EAS54_67:4:142:943:582 73 chr2 0 99 35M -1 -1 0 TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA MF:C:18 Aq:C:41 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
EAS54_67:6:43:859:229 153 chr2 0 66 35M -1 -1 0 TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA MF:C:32 Aq:C:0 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
--------------
Introduction
------------
Next-Generation Sequencing
~~~~~~~~~~~~~~~~~~~~~~~~~~
The field of genomics requires sequencing data produced by
Next-Generation sequencing (NGS) platforms (such as
`Illumina <https://www.illumina.com/>`__). These data take the form of
millions of short strings that represent the nucleotide sequences (A, T,
C, or G) of the sample fragments processed by the NGS platform. More
information regarding the NGS workflow can be found
`here <https://www.illumina.com/content/dam/illumina-marketing/documents/products/illumina_sequencing_introduction.pdf>`__
An example of a single entry (known as FASTQ) can be seen below (`FASTQ
Format <https://en.wikipedia.org/wiki/FASTQ_format>`__):
.. code:: bash
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
Each entry details the read name, lenght, string representation, and
quality of each aligned base along the read. ### SAM/BAM Format The data
from the NGS platforms are often aligned to reference genome. That is,
each entry goes through an alignment algorithm that finds the best
position that the entry matches along a known reference sequence. The
alignment step extends the original entry with a sundry of additional
attributes. A few of the included attributes are contig, position, and
Compact Idiosyncratic Gapped Alignment Report (CIGAR) string. The
modified entry is called the An example Sequence Alignment Map (SAM)
entry can be see below (`SAM
format <https://samtools.github.io/hts-specs/SAMv1.pdf>`__):
.. code:: bash
@HD VN:1.5 SO:coordinate
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r002 0 ref 9 30 3S6M1P1I4M * 0 0 AAAAGATAAGGATA *
r003 0 ref 9 30 5S6M * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r004 0 ref 16 30 6M14N5M * 0 0 ATAGCTTCAGC *
r003 2064 ref 29 17 6H5M * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 37 30 9M = 7 -39 CAGCGGCAT * NM:i:1
There are many benefits to the SAM format: human-readable, each entry is
contained to a single line (supporting simple stream analysis), concise
description of the read's quality and position, and a file header
metadata that supports integrity and reproducibility. Additionally, a
compressed form of the SAM format was designed in parallel. It is called
the Binary Alignment Map
(`BAM <https://samtools.github.io/hts-specs/SAMv1.pdf>`__). Using a
series of clever byte encoding of each SAM entry, the data are
compressed into specialized, concatenated GZIP blocks called Blocked GNU
Zip Format (`BGZF <https://samtools.github.io/hts-specs/SAMv1.pdf>`__)
blocks. Each BGZF block contains a finite amount of data (≈65Kb). While
the whole file is GZIP compatible, each individual block is also
independently GZIP compatible. This data structure, ultimately, makes
the file larger than just a normal GZIP file, but it also allow for
random access within the file though the use of a BAM Index file
(`BAI <https://samtools.github.io/hts-specs/SAMv1.pdf>`__). ### BAI The
BAI file, often produced via
`samtools <http://samtools.sourceforge.net/>`__, requires the BAM file
to be sorted prior to indexing. Using a modified R-tree binning
strategy, each reference contig is divided into sequential,
non-overlapping bins. That is a parent bin may contain numerous
children, but none of the children bins overlap another's assigned
interval. Each BAM entry is then assigned to the bin that fully contains
it. A visual description of the binning strategy can be found
`here <https://samtools.github.io/hts-specs/SAMv1.pdf>`__. Each bin is
comprised of chunks, and each chunk contains its respective start and
stop byte positions within the BAM file. In addition to the bin index, a
linear index is produced as well. Again, the reference contig is divided
into equally sized windows (covering ≈16Kbp/each). Along those windows,
the start offset of the first read that ***overlaps*** that window is
stored. Now, given a region of interest, the first bin that overlaps the
region is looked up. The chunks in the bin are stored as *virtual
offsets*. A virtual offset is a 64-bit unsigned integer that is
comprised of the compressed offset ``coffset`` (indicating the byte
position of the start of the containing BGZF block) and the uncompressed
offset ``uoffset`` (indicating the byte position within the uncompressed
data of the BGZF block that the data starts). A virtual offset is
calculated by:
.. code:: python
virtual_offset = coffset << 16 | uoffset
Similarly, the complement of the above is as follows:
.. code:: python
coffset = virtual_offset >> 16
uoffset = virtual_offset ^ (coffset << 16)
A simple ``seek()`` call against the BAM file will put the head at the
start of your region of interest. \*\ ** ## Motivation The common
practice within the field of genomics/genetics when analyzing BAM files
is to use the program known as
`samtools <http://samtools.sourceforge.net/>`__. The maintainers of
samtools have done a tremendous job of providing distributions that work
on a multitude of operating systems. While samtools is powerful, as a
command line interface, it is also limited in that it doesn't really
afford the ability to perform real-time dynamic processing of reads
(without requiring many system calls to samtools). Due to its general
nature and inherent readability, a package was written in Python called
`pysam <https://github.com/pysam-developers/pysam>`__. This package
allowed users a very comfortable means to doing such dynamic processing.
However, the foundation of these tools is built on a C-API called
`htslib <https://github.com/samtools/htslib>`__ and htslib cannot be
compiled in a Windows environment. By extension, neither can pysam. In
building a tool for genomic visualization, I wanted it to be platform
agnostic. This is precisely when I found out that the tools I had
planned to use as a backend did not work on Windows...the most prevalent
operation system in the end-user world. So, I wrote **\ bamnostic\*\*.
As of this writing, bamnostic is OS-agnostic and written completely in
Pure Python--requiring only the standard library (and ``pytest`` for the
test suite). Special care was taken to ensure that it would run on all
versions of CPython 2.7 or greater. Additionally, it runs in both stable
versions of PyPy. While it may perform slower than its C counterparts,
bamnostic instills diversity and inclusion...opening up the science to a
much greater demographic. Lastly, it is lightweight enough to fit into
any simple web server (e.g. `Flask <http://flask.pocoo.org/>`__),
further expanding the science of genetics/genomics.
.. |PyPI version| image:: https://badge.fury.io/py/bamnostic.svg
:target: https://badge.fury.io/py/bamnostic
.. |License| image:: https://img.shields.io/badge/License-BSD%203--Clause-blue.svg
:target: https://opensource.org/licenses/BSD-3-Clause
| # BAMnostic a *pure Python*, **OS-agnositic** Binary Alignment Map
(BAM) file parser and random access tool. \*\*\* ## Installation There
are 3 methods of installation available (choose one): Through the
Python Package Index (`PyPI <https://pypi.org/>`__)
.. code:: bash
pip install bamnostic
# or, if you don't have superuser access
pip install --user bamnostic
2
.. code:: bash
# again, use --user if you don't have superuser access
pip install -e git+https://github.com/betteridiot/bamnostic.git
# or, if you don't have superuser access
pip install --user -e git+https://github.com/betteridiot/bamnostic.git
3
.. code:: bash
git clone https://github.com/betteridiot/bamnostic.git
cd bamnostic
pip install -e .
# or, if you don't have superuser access
pip install --user -e .
Quickstart
----------
--------------
Bamnostic is meant to be a reduced drop-in replacement for
`pysam <https://github.com/pysam-developers/pysam>`__. As such it has
much the same API as ``pysam`` with regard to BAM-related operations.
**Note**: the ``pileup()`` method is not supported at this time. ###
Importing
.. code:: python
import bamnostic as bs
Loading your BAM file
~~~~~~~~~~~~~~~~~~~~~
Bamnostic comes with an example BAM (and respective BAI) file just to
play around with the output. Note, however, that the example BAM file
does not contain many reference contigs. Therefore, random access is
limited. This example file is made availble through
``bamnostic.example_bam``, which is a just a string path to the BAM file
within the package.
.. code:: python
bam = bs.AlignmentFile(bs.example_path, 'rb')
Get the header
~~~~~~~~~~~~~~
**Note**: this will print out the SAM header. If the SAM header is not
in the BAM file, it will print out the dictionary representation of the
BAM header. It is a dictionary of refID keys with contig names and
length tuple values.
.. code:: python
bam.header
>>> {0: ('chr1', 1575), 1: ('chr2', 1584)}
Data validation through ``head()``
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
.. code:: python
bam.head(n=2)
>>>EAS56_57:6:190:289:82 69 chr1 99 0 0 99 0 CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA MF:C:192
EAS56_57:6:190:289:82 137 chr1 99 73 35M 0 99 0 AGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCAC
Getting the first read
~~~~~~~~~~~~~~~~~~~~~~
.. code:: python
first_read = next(bam)
print(first_read)
>>> EAS56_57:6:190:289:82 69 chr1 99 0 0 99 0 CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA MF:C:192
Exploring the read
~~~~~~~~~~~~~~~~~~
.. code:: python
# read name
print(first_read.read_name)
>>> EAS56_57:6:190:289:82
# 0-based position
print(first_read.pos)
>>> 99
# nucleotide sequence
print(first_read.seq)
>>> CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA
# Read FLAG
print(first_read.flag)
>>> 69
# decoded FLAG
bs.utils.flag_decode(first_read.flag)
>>> [(1, 'read paired'), (4, 'read unmapped'), (64, 'first in pair')]
Random Access
~~~~~~~~~~~~~
.. code:: python
for i, read in enumerate(bam.fetch('chr2', 1, 100)):
if i >= 3:
break
print(read)
>>> B7_591:8:4:841:340 73 chr2 0 99 36M -1 -1 0 TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAA MF:C:18 Aq:C:77 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
EAS54_67:4:142:943:582 73 chr2 0 99 35M -1 -1 0 TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA MF:C:18 Aq:C:41 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
EAS54_67:6:43:859:229 153 chr2 0 66 35M -1 -1 0 TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA MF:C:32 Aq:C:0 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
--------------
Introduction
------------
Next-Generation Sequencing
~~~~~~~~~~~~~~~~~~~~~~~~~~
The field of genomics requires sequencing data produced by
Next-Generation sequencing (NGS) platforms (such as
`Illumina <https://www.illumina.com/>`__). These data take the form of
millions of short strings that represent the nucleotide sequences (A, T,
C, or G) of the sample fragments processed by the NGS platform. More
information regarding the NGS workflow can be found
`here <https://www.illumina.com/content/dam/illumina-marketing/documents/products/illumina_sequencing_introduction.pdf>`__
An example of a single entry (known as FASTQ) can be seen below (`FASTQ
Format <https://en.wikipedia.org/wiki/FASTQ_format>`__):
.. code:: bash
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
Each entry details the read name, lenght, string representation, and
quality of each aligned base along the read. ### SAM/BAM Format The data
from the NGS platforms are often aligned to reference genome. That is,
each entry goes through an alignment algorithm that finds the best
position that the entry matches along a known reference sequence. The
alignment step extends the original entry with a sundry of additional
attributes. A few of the included attributes are contig, position, and
Compact Idiosyncratic Gapped Alignment Report (CIGAR) string. The
modified entry is called the An example Sequence Alignment Map (SAM)
entry can be see below (`SAM
format <https://samtools.github.io/hts-specs/SAMv1.pdf>`__):
.. code:: bash
@HD VN:1.5 SO:coordinate
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r002 0 ref 9 30 3S6M1P1I4M * 0 0 AAAAGATAAGGATA *
r003 0 ref 9 30 5S6M * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r004 0 ref 16 30 6M14N5M * 0 0 ATAGCTTCAGC *
r003 2064 ref 29 17 6H5M * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 37 30 9M = 7 -39 CAGCGGCAT * NM:i:1
There are many benefits to the SAM format: human-readable, each entry is
contained to a single line (supporting simple stream analysis), concise
description of the read's quality and position, and a file header
metadata that supports integrity and reproducibility. Additionally, a
compressed form of the SAM format was designed in parallel. It is called
the Binary Alignment Map
(`BAM <https://samtools.github.io/hts-specs/SAMv1.pdf>`__). Using a
series of clever byte encoding of each SAM entry, the data are
compressed into specialized, concatenated GZIP blocks called Blocked GNU
Zip Format (`BGZF <https://samtools.github.io/hts-specs/SAMv1.pdf>`__)
blocks. Each BGZF block contains a finite amount of data (≈65Kb). While
the whole file is GZIP compatible, each individual block is also
independently GZIP compatible. This data structure, ultimately, makes
the file larger than just a normal GZIP file, but it also allow for
random access within the file though the use of a BAM Index file
(`BAI <https://samtools.github.io/hts-specs/SAMv1.pdf>`__). ### BAI The
BAI file, often produced via
`samtools <http://samtools.sourceforge.net/>`__, requires the BAM file
to be sorted prior to indexing. Using a modified R-tree binning
strategy, each reference contig is divided into sequential,
non-overlapping bins. That is a parent bin may contain numerous
children, but none of the children bins overlap another's assigned
interval. Each BAM entry is then assigned to the bin that fully contains
it. A visual description of the binning strategy can be found
`here <https://samtools.github.io/hts-specs/SAMv1.pdf>`__. Each bin is
comprised of chunks, and each chunk contains its respective start and
stop byte positions within the BAM file. In addition to the bin index, a
linear index is produced as well. Again, the reference contig is divided
into equally sized windows (covering ≈16Kbp/each). Along those windows,
the start offset of the first read that ***overlaps*** that window is
stored. Now, given a region of interest, the first bin that overlaps the
region is looked up. The chunks in the bin are stored as *virtual
offsets*. A virtual offset is a 64-bit unsigned integer that is
comprised of the compressed offset ``coffset`` (indicating the byte
position of the start of the containing BGZF block) and the uncompressed
offset ``uoffset`` (indicating the byte position within the uncompressed
data of the BGZF block that the data starts). A virtual offset is
calculated by:
.. code:: python
virtual_offset = coffset << 16 | uoffset
Similarly, the complement of the above is as follows:
.. code:: python
coffset = virtual_offset >> 16
uoffset = virtual_offset ^ (coffset << 16)
A simple ``seek()`` call against the BAM file will put the head at the
start of your region of interest. \*\ ** ## Motivation The common
practice within the field of genomics/genetics when analyzing BAM files
is to use the program known as
`samtools <http://samtools.sourceforge.net/>`__. The maintainers of
samtools have done a tremendous job of providing distributions that work
on a multitude of operating systems. While samtools is powerful, as a
command line interface, it is also limited in that it doesn't really
afford the ability to perform real-time dynamic processing of reads
(without requiring many system calls to samtools). Due to its general
nature and inherent readability, a package was written in Python called
`pysam <https://github.com/pysam-developers/pysam>`__. This package
allowed users a very comfortable means to doing such dynamic processing.
However, the foundation of these tools is built on a C-API called
`htslib <https://github.com/samtools/htslib>`__ and htslib cannot be
compiled in a Windows environment. By extension, neither can pysam. In
building a tool for genomic visualization, I wanted it to be platform
agnostic. This is precisely when I found out that the tools I had
planned to use as a backend did not work on Windows...the most prevalent
operation system in the end-user world. So, I wrote **\ bamnostic\*\*.
As of this writing, bamnostic is OS-agnostic and written completely in
Pure Python--requiring only the standard library (and ``pytest`` for the
test suite). Special care was taken to ensure that it would run on all
versions of CPython 2.7 or greater. Additionally, it runs in both stable
versions of PyPy. While it may perform slower than its C counterparts,
bamnostic instills diversity and inclusion...opening up the science to a
much greater demographic. Lastly, it is lightweight enough to fit into
any simple web server (e.g. `Flask <http://flask.pocoo.org/>`__),
further expanding the science of genetics/genomics.
.. |PyPI version| image:: https://badge.fury.io/py/bamnostic.svg
:target: https://badge.fury.io/py/bamnostic
.. |License| image:: https://img.shields.io/badge/License-BSD%203--Clause-blue.svg
:target: https://opensource.org/licenses/BSD-3-Clause
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distributions
No source distribution files available for this release.See tutorial on generating distribution archives.
Built Distribution
Close
Hashes for bamnostic-0.4.2b4-py2.py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | cc2426cb774edd060de8e63f14c63a698f560a3d86f08ccd91559a2482de1505 |
|
MD5 | 23f9b9c7afa30536462c6e3e423e0a4b |
|
BLAKE2b-256 | 250291c0fd34237db008b612d3032a15a31b84535381a0f93cf65a8c8bb62a10 |