Skip to main content

Intuitive API wrapper framework for Benchling

Project description

Description
===========

Benchling provides a convenient way to store DNA sequences (plasmids,
primers, pcr fragments, etc.) for an entire lab. This repo provides a
convinient wrapper for making Benchling API requests.

Features:

.. raw:: html

<ul>

.. raw:: html

<li>

Accessing Benchling sequences and folders

.. raw:: html

</li>

.. raw:: html

<li>

Creating new sequences and folders

.. raw:: html

</li>

.. raw:: html

<li>

Searching through sequences and folders using regular expressions

.. raw:: html

</li>

.. raw:: html

<li>

Converting Benchling sequence JSON to genbank or FASTA files

.. raw:: html

</li>

.. raw:: html

<li>

Opening and accessing sequences in a Benchling Share links

.. raw:: html

</li>

.. raw:: html

</ul>

Installation
============

::

cd directory/that/contains/benchling-api
pip install .

Usage
=====

Initializing the API object
---------------------------

The BenchlingAPI object provides an interface for accessing Benchling
sequences. It requires a benchling API-key, which can be requested from
Benchling. More information on the Benchling API can be accessed here:
https://api.benchling.com/docs/.

::

from benchlingapi import BenchlingAPI

bench_api_key = 'sk_g7fo2vxskNUYffNPkShOFIsOmtY9ejIXX'
benchlingapi = BenchlingAPI(bench_api_key)

The first argument is the Benchling API key, which can be requested
through benchling and accessed by scrolling to the bottom of you account
information on Benchling.

Find
^^^^

getting folders

.. code:: json

{'count': 59, 'created_at': '2013-10-01T20:07:18+00:00', 'description': '', 'id': 'lib_pP6d50rJn1', 'modified_at': '2017-01-20T21:57:55.991758+00:00', 'name': 'Plasmids', 'owner': 'ent_A7BlnCcJTU', 'permissions': {'admin': True, 'appendable': True, 'owner': False, 'readable': True, 'writable': True}, 'sequences': [{'id': 'seq_wHiaXdFM', 'name': 'pGPT4-pGAL1-G(m)AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_WQ0wqb9f', 'name': 'pMODU6-pGALZ4-iaaH', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_okitCPyx', 'name': 'pGPT4-pGAL1-GAVNY(VP64)', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_bw3XWuZU', 'name': 'pMODT4-pGALZ4-AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_K5hwGNwg', 'name': 'pMODU6-pGAL1-BleoMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_AyQ7ToIn', 'name': 'pBR322 (Sample Sequence)', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_t77GYXRB', 'name': 'pGPT4-pGAL1-EGFP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_5bmPzcKN', 'name': 'pMODU6-pGALZ4-NatMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_Na2oNxzs', 'name': 'pMODU6-pGALZ4-FAR1-mut-87aa', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_0FmHFzJe', 'name': 'pMODT4-pGAL1-attB1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_m42PVReQ', 'name': 'pMODT4-pGALZ4-Z4AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_mfMW58Dd', 'name': 'pGPL5G-pGALZ4-URA3', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_QteKmJdS', 'name': 'pGPT4-pGAL1-GAVNY_mutated_library', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_usn0K27s', 'name': 'pMODU6-pGALZ4-BleoMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_i0Yl6uzk', 'name': 'pMODH8-pGPD-TIR1_DM', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_TWAJLtvz', 'name': 'pMODU6-pGAL1-P1G1-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_2rKmILGU', 'name': 'pMODU6-pGAL1-NatMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_5AXMlSvB', 'name': 'pYMOD2Kmx_pGAL1-HYG_pGAL1-iaah', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_qihkmlW4', 'name': 'pMODU6-pGAL1-AlphaFactor', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_k0MuYdIM', 'name': 'pMODU6-pGAL1-IAA17T2-FAR1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_7yXay7Ep', 'name': 'pGP8G-TIR1-Y', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_GuqSGBXY', 'name': 'pGPT4-pGAL1-GAVNY(VP64) new design', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_fkFjzKkb', 'name': 'v63_pGP8zGAL-STE5(-)RING-SNC2 C-term', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_PKJNfuZA', 'name': 'pGPH8-pGAL1-GAVNY_v2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_f4GgnFdY', 'name': 'pGPT4-pGAL1-GAVNY_seq_verified', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_SGfG2YeB', 'name': 'pMODU6-pGALZ4-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_vA5dxrqd', 'name': 'pMODU6-pGALZ4-AlphaFactor', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_tMz0Xv3g', 'name': 'pMODU6-pGAL1-FAR1-L1-IAA17T2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_2xGw2yCj', 'name': 'pGPH8-pGAL1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_rwDoRd9Q', 'name': 'pMODU6-pGALZ4-FAR1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_ri07UntS', 'name': 'pMODU6-pGPD-EYFP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_TsTM0B8q', 'name': 'pMOD4-pGAL1Z3(P3)-MF(AL', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_QGfqobtP', 'name': 'pGPT4-pGAL1-AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_9ph0SnJV', 'name': 'AmpR-T4-pGAL1-GAL4DBD-L1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_F4tEc0XU', 'name': 'pMODU6-pGALZ4-STE5(-)RING', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_iGdjEEx4', 'name': 'pGPT4-pGAL1-P1G1-GEV', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_hhI5TTbO', 'name': 'pMODU6-pGAL1-FAR1-IAA17T2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_AgQ1w9ak', 'name': 'pLAB2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_y9xdtVx7', 'name': 'pMODKan-HO-pACT1GEV', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_D1iAdKMz', 'name': 'pGPL5G-pGAL1-URA3', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_etTsAfD4', 'name': 'pGPU6-pGALZ4-eYFP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_5HcRWKi8', 'name': 'pMODU6-pGALZ4-P1G1-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_Qc6f2Kii', 'name': 'pMOD4G-NLS_dCas9_VP64', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_VazadBJw', 'name': 'pGPT4-pGAL1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_ztl4dnOW', 'name': 'pLAB1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_kKtPZ1Rs', 'name': 'pMODT4-pGAL1-P1G1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_4ccBmI1j', 'name': 'pGPU6-pGAL1-AFB2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_tFGIIL0C', 'name': 'pMODU6-pGAL1-FAR1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_7O7ThYSI', 'name': 'pMODU6-pGALZ4-Z4AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_w2IZPFzd', 'name': 'pMODOK-pACT1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_UbsucV1t', 'name': 'pMODU6-pGAL1-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_Nv6wYspV', 'name': 'FAR1-mut-87aa-TP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_rzQGBzv2', 'name': 'pGP5G-ccdB', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_QuWMpfRK', 'name': 'pMODT4-pGAL1-attB1-GVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_l5VHTc8Z', 'name': 'pGPU6-pGAL1-TIR1_DM', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_6VN5FDpP', 'name': 'pMODOK-pACT1-GAVN', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_2MFFshfl', 'name': 'pYMOD2Kmx_pGAL1-HYG_ZEV4-cassette', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_IyZI9bEh', 'name': 'pMODU6-pGAL1-FAR1-L1-IAA17T1_opt', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_beOWphBv', 'name': 'pMODKan-HO-pACT1-ZEV4', 'folder': 'lib_pP6d50rJn1'}], 'type': 'ALL'}

e.g. find all sequences that contain the word "CRY2" in the name

::

benchlingapi.findSequence('CRY2', query='name', regex=True)

e.g. find all sequences that with regular expression pattern

::

benchlingapi.findSequence('\wcas9.+', query='name', regex=True)

e.g. find all sequence with id 'seq\_aupKOZRb'

::

benchlingapi.findSequence('seq_aupKOZRb', query='id', regex=False)

e.g. find all folders that contain the word "CRY2" in the name

::

benchlingapi.findFolder('CRY2', query='name', regex=True)

e.g. get all folders

::

benchlingapi.getFolderList()

e.g. get all sequences

::

benchlingapi.getSequenceList()

e.g. get sequence from a share link

::

benchlingapi.getSequenceFromShareLink('share_link')

Create
^^^^^^

e.g. create a folder

::

benchlingapi.createFolder('new_folder', description='this is a new folder', owner='ent_OMJXXX')

e.g. create a sequence

::

benchlingapi.createSequence(
'sequence name', #name
'agggggggtctgtagctgacttatcgtatgtgcgcga', #bases
True, #circular or not
'lib_0g4T1FJV', #folder_id
description='sequence description',
#annotations=[], #annotations are not currently supported in Benchling's api
)


e.g. create a folder

::

benchlingapi.createFolder('folder_Name', description='folder_description', 'owner'='ent_OMJXXX')

Delete
^^^^^^

e.g. delete a folder

::

benchlingapi.deleteFolder(folder_id)

e.g. delete a sequence

::

benchlingapi.deleteSequence(folder_id)

Edit
^^^^

e.g. edit a folder

::

benchlingapi.patchFolder(name=None, description=None, owner=None)

e.g. edit a sequence

::

benchlingapi.patchsequence(name=None, bases=None, circular=None,
folder=None, description=None, color=None)

BenchlingPortal
---------------

Not supported for non-aquarium users

Project details


Release history Release notifications

This version
History Node

1.0

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Filename, size & hash SHA256 hash help File type Python version Upload date
benchlingapi-1.0.tar.gz (11.3 kB) Copy SHA256 hash SHA256 Source None

Supported by

Elastic Elastic Search Pingdom Pingdom Monitoring Google Google BigQuery Sentry Sentry Error logging AWS AWS Cloud computing DataDog DataDog Monitoring Fastly Fastly CDN SignalFx SignalFx Supporter DigiCert DigiCert EV certificate StatusPage StatusPage Status page