Skip to main content

Store any file as a fasta file

Project description

Disclaimer: this is only a proof-of-concept (and a joke), please don't actually use this.

bin2fasta

Store any file as a fasta file!

Installation

$ pip install bin2fasta

Usage

$ bin2fasta --help
Usage: bin2fasta [OPTIONS] FILENAME

  Store any file as a fasta file

Options:
  -D, --decode           Enable conversion from FASTA to
                         binary.
  -o, --output FILENAME  File to write to.
  --help                 Show this message and exit.

Basic example:

$ file foo.png
foo.png: PNG image data, 618 x 257, 8-bit/color RGBA, non-interlaced
$ bin2fasta -o bar.fasta foo.png
319400it [00:00, 683649.99it/s]
$ head -c50 bar.fasta
>Sequence_master
AGTTGAGGCGCCTTACTGCCGAATTAGTTAAGA
$ bin2fasta --decode -o baz.png bar.fasta
159700it [00:00, 455825.67it/s]
$ file baz.png
baz.png: PNG image data, 618 x 257, 8-bit/color RGBA, non-interlaced
$ diff foo.png baz.png
$

Note that you can easily chain multiple commands by piping their respective outputs and using -:

$ cat foo.png | xz | gpg -c | bin2fasta - > bar.fasta
$ cat bar.fasta | bin2fasta -D - | gpg -d | xz --decompress > baz.png
$ diff foo.png baz.png
$

Poetry workflow

Only relevant for developers:

Run executable:

$ poetry run bin2fasta

Publish to PyPi:

$ poetry --build publish

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Files for bin2fasta, version 0.0.2
Filename, size File type Python version Upload date Hashes
Filename, size bin2fasta-0.0.2-py3-none-any.whl (8.2 kB) File type Wheel Python version py3 Upload date Hashes View hashes
Filename, size bin2fasta-0.0.2.tar.gz (4.0 kB) File type Source Python version None Upload date Hashes View hashes

Supported by

Elastic Elastic Search Pingdom Pingdom Monitoring Google Google BigQuery Sentry Sentry Error logging AWS AWS Cloud computing DataDog DataDog Monitoring Fastly Fastly CDN SignalFx SignalFx Supporter DigiCert DigiCert EV certificate StatusPage StatusPage Status page