Skip to main content

CodExt Tweet

Encode/decode anything.

PyPi Read The Docs Build Status Coverage Status Python Versions Known Vulnerabilities DOI License

CodExt is a (Python2-3 compatible) library that extends the native codecs library (namely for adding new custom encodings and character mappings) and provides 120+ new codecs, hence its name combining CODecs EXTension. It also features a guess mode for decoding multiple layers of encoding and CLI tools for convenience.

$ pip install codext
Want to contribute a new codec ? Want to contribute a new macro ?
Check the documentation first
Then PR your new codec
PR your updated version of macros.json

Demonstrations

Using CodExt from the command line

Using base tools from the command line

Using the unbase command line tool

//img.shields.io/badge/Tweet%20(codext)--lightgrey?logo=twitter&style=social" alt="Tweet on codext" height="20"/>

$ codext -i test.txt encode dna-1
GTGAGCGGGTATGTGA

$ echo -en "test" | codext encode morse
- . ... -

$ echo -en "test" | codext encode braille
⠞⠑⠎⠞

$ echo -en "test" | codext encode base100
👫👜👪👫

Chaining codecs

$ echo -en "Test string" | codext encode reverse
gnirts tseT

$ echo -en "Test string" | codext encode reverse morse
--. -. .. .-. - ... / - ... . -

$ echo -en "Test string" | codext encode reverse morse dna-2
AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC

$ echo -en "Test string" | codext encode reverse morse dna-2 octal
101107124103101107124103101107124107101107101101101107124103101107124107101107101101101107124107101107124107101107101101101107124107101107124103101107124107101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124124101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124107101107101101101107124103

$ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC" | codext -d dna-2 morse reverse
test string

Using macros

$ codext add-macro my-encoding-chain gzip base63 lzma base64

$ codext list macros
example-macro, my-encoding-chain

$ echo -en "Test string" | codext encode my-encoding-chain
CQQFAF0AAIAAABuTgySPa7WaZC5Sunt6FS0ko71BdrYE8zHqg91qaqadZIR2LafUzpeYDBalvE///ug4AA==

$ codext remove-macro my-encoding-chain

$ codext list macros
example-macro

//img.shields.io/badge/Tweet%20(unbase)--lightgrey?logo=twitter&style=social" alt="Tweet on unbase" height="20"/>

Playing with base encodings.

$ echo "Test string !" | base122
*.7!ft9�-f9Â

$ echo "Test string !" | base91 
"ONK;WDZM%Z%xE7L

$ echo "Test string !" | base91 | base85
B2P|BJ6A+nO(j|-cttl%

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr
QVx5tvgjvCAkXaMSuKoQmCnjeCV1YyyR3WErUUErFf

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | base58-flickr -d | base36 -d | base85 -d | base91 -d
Test string !
$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -m 3
Test string !

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -f Test
Test string !

Usage (CLI)

Listing codecs.

$ codext list encodings
a1z26                      adler32               affine             alternative-rot        ascii           
atbash                     autoclave             bacon              barbie                 base            
base1                      base2                 base3              base4                  base8           
<<snipped>>

Finding a codec based on a name.

$ codext search bitcoin
base58

Encoding a string.

$ echo -en "This is a test" | codext encode polybius
44232443 2443 11 44154344

Encoding a file.

$ echo -en "this is a test" > to_be_encoded.txt
$ codext encode base64 < to_be_encoded.txt > text.b64
$ cat text.b64 
dGhpcyBpcyBhIHRlc3Q=

Chaining codecs.

$ echo -en "mrdvm6teie6t2cq=" | codext encode upper | codext decode base32 | codext decode base64
test

Iteratively guessing decodings.

$ echo -en "test" | codext encode base64 gzip | codext guess
Codecs: gzip
dGVzdA==
$ echo -en "test" | codext encode base64 gzip | codext guess gzip -i base
Codecs: gzip, base64
test

Usage (Python)

Getting the list of available codecs.

>>> import codext

>>> codext.list()
['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']

Playing with some base encodings.

```python
>>> codext.encode("this is a test", "base58-bitcoin")
'jo91waLQA1NNeBmZKUF'

>>> codext.encode("this is a test", "base58-ripple")
'jo9rA2LQwr44eBmZK7E'

>>> codext.encode("this is a test", "base58-url")
'JN91Wzkpa1nnDbLyjtf'

>>> codecs.encode("this is a test", "base100")
'👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫'

>>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
'this is a test'

Playing with some cryptography-based codecs.

>>> codext.encode("This is a test !", "vigenere-MYSECRETKET")
'Ffaw kj e mowm !'

>>> codext.encode("This is a test !", "autoclave-SECRET")
'Llkj ml t amkb !'

Encoding/decoding with various other codecs.

>>> for i in range(8):
        print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'

>>> codecs.encode("this is a test", "morse")
'- .... .. ... / .. ... / .- / - . ... -'

>>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
'this is a test'

>>> with open("morse.txt", 'w', encoding="morse") as f:
	f.write("this is a test")
14

>>> with open("morse.txt",encoding="morse") as f:
	f.read()
'this is a test'

>>> print(codext.encode("An example test string", "baudot-tape"))
***.**
   . *
***.* 
*  .  
   .* 
*  .* 
   . *
** .* 
***.**
** .**
   .* 
*  .  
* *. *
   .* 
* *.  
* *. *
*  .  
* *.  
* *. *
***.  
  *.* 
***.* 
 * .* 

List of codecs

BaseXX

  • base1: useless, but for the sake of completeness
  • base2: simple conversion to binary (with a variant with a reversed alphabet)
  • base3: conversion to ternary (with a variant with a reversed alphabet)
  • base4: conversion to quarternary (with a variant with a reversed alphabet)
  • base8: simple conversion to octal (with a variant with a reversed alphabet)
  • base10: simple conversion to decimal
  • base11: conversion to digits with a "a"
  • base16: simple conversion to hexadecimal (with a variant holding an alphabet with digits and letters inverted)
  • base26: conversion to alphabet letters
  • base32: classical conversion according to the RFC4648 with all its variants (zbase32, extended hexadecimal, geohash, Crockford)
  • base36: Base36 conversion to letters and digits (with a variant inverting both groups)
  • base45: Base45 DRAFT algorithm (with a variant inverting letters and digits)
  • base58: multiple versions of Base58 (bitcoin, flickr, ripple)
  • base62: Base62 conversion to lower- and uppercase letters and digits (with a variant with letters and digits inverted)
  • base63: similar to base62 with the "_" added
  • base64: classical conversion according to RFC4648 with its variant URL (or file) (it also holds a variant with letters and digits inverted)
  • base67: custom conversion using some more special characters (also with a variant with letters and digits inverted)
  • base85: all variants of Base85 (Ascii85, z85, Adobe, (x)btoa, RFC1924, XML)
  • base91: Base91 custom conversion
  • base100 (or emoji): Base100 custom conversion
  • base122: Base100 custom conversion
  • base-genericN: see base encodings ; supports any possible base

This category also contains ascii85, adobe, [x]btoa, zeromq with the base85 codec.

Binary

  • baudot: supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ...
  • baudot-spaced: variant of baudot ; groups of 5 bits are whitespace-separated
  • baudot-tape: variant of baudot ; outputs a string that looks like a perforated tape
  • bcd: Binary Coded Decimal, encodes characters from their (zero-left-padded) ordinals
  • bcd-extended0: variant of bcd ; encodes characters from their (zero-left-padded) ordinals using prefix bits 0000
  • bcd-extended1: variant of bcd ; encodes characters from their (zero-left-padded) ordinals using prefix bits 1111
  • excess3: uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals
  • gray: aka reflected binary code
  • manchester: XORes each bit of the input with 01
  • manchester-inverted: variant of manchester ; XORes each bit of the input with 10
  • rotateN: rotates characters by the specified number of bits (N belongs to [1, 7] ; Python 3 only)

Checksums

  • adler: Adler32 algorithm (relies on zlib)
  • crc: CRC of lengths 8, 10-17, 21, 24, 30-32, 40, 64, 82 with a variety of polynoms
  • luhn: Luhn mod N algorithm

Common

  • a1z26: keeps words whitespace-separated and uses a custom character separator
  • cases: set of case-related encodings (including camel-, kebab-, lower-, pascal-, upper-, snake- and swap-case, slugify, capitalize, title)
  • dummy: set of simple encodings (including integer, replace, reverse, word-reverse, substite and strip-spaces)
  • octal: dummy octal conversion (converts to 3-digits groups)
  • octal-spaced: variant of octal ; dummy octal conversion, handling whitespace separators
  • ordinal: dummy character ordinals conversion (converts to 3-digits groups)
  • ordinal-spaced: variant of ordinal ; dummy character ordinals conversion, handling whitespace separators

Compression

  • gzip: standard Gzip compression/decompression
  • lz77: compresses the given data with the algorithm of Lempel and Ziv of 1977
  • lz78: compresses the given data with the algorithm of Lempel and Ziv of 1978
  • pkzip_deflate: standard Zip-deflate compression/decompression
  • pkzip_bzip2: standard BZip2 compression/decompression
  • pkzip_lzma: standard LZMA compression/decompression

:warning: Compression functions are of course definitely NOT encoding functions ; they are implemented for leveraging the .encode(...) API from codecs.

Cryptography

  • affine: aka Affine Cipher
  • atbash: aka Atbash Cipher
  • autoclave: aka Autoclave/Autokey Cipher (variant of Vigenere Cipher)
  • bacon: aka Baconian Cipher
  • barbie-N: aka Barbie Typewriter (N belongs to [1, 4])
  • beaufort: aka Beaufort Cipher (variant of Vigenere Cipher)
  • citrix: aka Citrix CTX1 password encoding
  • playfair: aka Playfair Cipher
  • phillips: aka Phillips Cipher (polyalphabetic block cipher with 8 key squares)
  • polybius: aka Polybius Square Cipher
  • railfence: aka Rail Fence Cipher
  • rotN: aka Caesar cipher (N belongs to [1,25])
  • scytaleN: encrypts using the number of letters on the rod (N belongs to [1,[)
  • shiftN: shift ordinals (N belongs to [1,255])
  • trithemius: aka Trithemius Cipher (variant of Vigenere Cipher)
  • vic: aka VIC Cipher
  • vigenere: aka Vigenere Cipher
  • xorN: XOR with a single byte (N belongs to [1,255])

:warning: Crypto functions are of course definitely NOT encoding functions ; they are implemented for leveraging the .encode(...) API from codecs.

Hashing

  • blake: includes BLAKE2b and BLAKE2s (Python 3 only ; relies on hashlib)
  • crypt: Unix's crypt hash for passwords (Python 3 and Unix only ; relies on crypt)
  • md: aka Message Digest ; includes MD4 and MD5 (relies on hashlib)
  • sha: aka Secure Hash Algorithms ; includes SHA1, 224, 256, 384, 512 (Python2/3) but also SHA3-224, -256, -384 and -512 (Python 3 only ; relies on hashlib)
  • shake: aka SHAKE hashing (Python 3 only ; relies on hashlib)

:warning: Hash functions are of course definitely NOT encoding functions ; they are implemented for convenience with the .encode(...) API from codecs and useful for chaning codecs.

Languages

  • braille: well-known braille language (Python 3 only)
  • ipsum: aka lorem ipsum
  • galactic: aka galactic alphabet or Minecraft enchantment language (Python 3 only)
  • leetspeak: based on minimalistic elite speaking rules
  • morse: uses whitespace as a separator
  • navajo: only handles letters (not full words from the Navajo dictionary)
  • radio: aka NATO or radio phonetic alphabet
  • southpark: converts letters to Kenny's language from Southpark (whitespace is also handled)
  • southpark-icase: case insensitive variant of southpark
  • tap: converts text to tap/knock code, commonly used by prisoners
  • tomtom: similar to morse, using slashes and backslashes

Others

  • dna: implements the 8 rules of DNA sequences (N belongs to [1,8])
  • letter-indices: encodes consonants and/or vowels with their corresponding indices
  • markdown: unidirectional encoding from Markdown to HTML

Steganography

  • hexagram: uses Base64 and encodes the result to a charset of I Ching hexagrams (as implemented here)
  • klopf: aka Klopf code ; Polybius square with trivial alphabetical distribution
  • resistor: aka resistor color codes
  • rick: aka Rick cipher (in reference to Rick Astley's song "Never gonna give you up")
  • sms: also called T9 code ; uses "-" as a separator for encoding, "-" or "_" or whitespace for decoding
  • whitespace: replaces bits with whitespaces and tabs
  • whitespace_after_before: variant of whitespace ; encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "whitespace+2*after-3*before")

Web

  • html: implements entities according to this reference
  • url: aka URL encoding

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

codext-1.16.5.tar.gz (6.0 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

codext-1.16.5-py3-none-any.whl (149.5 kB view details)

Uploaded Python 3

File details

Details for the file codext-1.16.5.tar.gz.

File metadata

  • Download URL: codext-1.16.5.tar.gz
  • Upload date:
  • Size: 6.0 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.14

File hashes

Hashes for codext-1.16.5.tar.gz
Algorithm Hash digest
SHA256 b0d7d9e0ca36c045b649b58b4dc6034efebb47fde023019c32a2c596a2d2cbca
MD5 209358d97792fd9b98c14b471ab661e6
BLAKE2b-256 0582364430527c04ebd2473b59e6b4c85f07db494d68d7703397d475181a9e70

See more details on using hashes here.

Provenance

The following attestation bundles were made for codext-1.16.5.tar.gz:

Publisher: python-package.yml on dhondta/python-codext

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file codext-1.16.5-py3-none-any.whl.

File metadata

  • Download URL: codext-1.16.5-py3-none-any.whl
  • Upload date:
  • Size: 149.5 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.14

File hashes

Hashes for codext-1.16.5-py3-none-any.whl
Algorithm Hash digest
SHA256 37c38953e8c44a4dc1dfe71edf799bf25a03030b6d37f96281ef5ee2d3b418e3
MD5 7a41280d208217e3e1a7e2e04760b647
BLAKE2b-256 6b896a3aa9b55326a726aae65c6a3a39c251569e595ca982863319b1cc214542

See more details on using hashes here.

Provenance

The following attestation bundles were made for codext-1.16.5-py3-none-any.whl:

Publisher: python-package.yml on dhondta/python-codext

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Release history Release notifications | RSS feed

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page