Native codecs extension
Project description
Codecs Extension
This library extends the native codecs
library and provides some new encodings (static or parametrized, like rot-N
or xor-N
).
Codec | Conversions | Comment |
---|---|---|
affine |
Affine <-> text | aka Affine Cipher |
ascii85 |
Ascii85 <-> text | Python 3 only |
atbash |
Atbash <-> text | aka Atbash Cipher |
bacon |
Bacon <-> text | aka Baconian Cipher |
barbie-N |
Barbie <-> text | aka Barbie Typewriter (N belongs to [1, 4]) |
baseXX |
BaseXX <-> text | see base encodings |
braille |
braille <-> text | Python 3 only |
dna-N |
DNA-N <-> text | implements the 8 rules of DNA sequences (N belongs to [1,8]) |
leetspeak |
leetspeak <-> text | based on minimalistic elite speaking rules |
markdown |
markdown --> HTML | unidirectional |
morse |
morse <-> text | uses whitespace as a separator |
nokia3310 |
Nokia 3310 keystrokes <-> text | uses "- " as a separator for encoding, "- " or "_ " or whitespace for decoding |
ordinals |
Ordinals <-> text | dummy character ordinals conversion |
radio |
Radio <-> text | aka NATO or radio phonetic alphabet |
resistor |
Resistor <-> text | aka resistor color codes |
rot-N |
ROT(N) <-> text | aka Caesar cipher (N belongs to [1,25]) |
shift |
shift(N) <-> text | shift ordinals with N (belongs to [1,255]) |
url |
URL <-> text | aka URL encoding |
xor-N |
XOR(N) <-> text | XOR with a single byte (N belongs to [1,255]) |
whitespace |
Whitespaces <-> text | replaces bits with whitespaces and tabs |
Setup
This library is available on PyPi and can be simply installed using Pip:
$ pip install codext
or
$ pip3 install codext
Note: Some more encodings are available when installing in Python 3.
Usage (from terminal)
$ codext dna-1 -i test.txt
GTGAGCGGGTATGTGA
$ echo -en "test" | codext morse
- . ... -
Python 3 (includes Ascii85, Base85, Base100 and braille):
$ echo -en "test" | codext braille
⠞⠑⠎⠞
$ echo -en "test" | codext base100
👫👜👪👫
Usage (within Python)
Example with Base58:
>>> codext.encode("this is a test", "base58-bitcoin")
'jo91waLQA1NNeBmZKUF'
>>> codext.encode("this is a test", "base58-ripple")
'jo9rA2LQwr44eBmZK7E'
>>> codext.encode("this is a test", "base58-url")
'JN91Wzkpa1nnDbLyjtf'
Example with Base100 (emoji's):
>>> codecs.encode("this is a test", "base100")
'👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫'
>>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
'this is a test'
Example with DNA sequence encoding:
>>> for i in range(8):
print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'
Example with morse:
>>> codecs.encode("this is a test", "morse")
'- .... .. ... / .. ... / .- / - . ... -'
>>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
'this is a test'
>>> with open("morse.txt", 'w', encoding="morse") as f:
f.write("this is a test")
14
>>> with open("morse.txt",encoding="morse") as f:
f.read()
'this is a test'
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
codext-1.4.4.tar.gz
(32.0 kB
view hashes)