Skip to main content

A Python implementation to calculate codon pair score

Project description

Build Status PyPI version PyPI - Downloads DOI

codonpair

codonpair calculates codon pair score and codon pair bias. CPS values are identical to those produced by the perl script from Dimitris Papamichail (cps_perl directory) and, presumably, used in the following work:

Virus attenuation by genome-scale changes in codon pair bias.
Coleman JR1, Papamichail D, Skiena S, Futcher B, Wimmer E, Mueller S.
Science. 2008 Jun 27;320(5884):1784-7. doi: 10.1126/science.1155761.
https://www.ncbi.nlm.nih.gov/pubmed/18583614

Installation

Either, clone the repo and install with pip

git clone git@github.com:smsaladi/codonpair.git
pip install ./codonpair

Or... have pip handle the details:

pip install git+git://github.com/smsaladi/codonpair@master#codonpair

All dependencies should be checked for and, if necessary, installed automatically by pip.

Usage

Initialize a codonpair.CodonPair object by specifying a list of reference sequences CodonPair.from_sequences, from a named reference CodonPair.from_named_reference, a reference file CodonPair.from_reference_file, or simply providing a pd.DataFrame with codon counts to CodonPair.

The following named references are recognized/bundled with this package.

  • E. coli (BL21 DE3)
  • S. pneumoniae (TIGR4)
  • cps_perl - the reference file provided with the perl implementation

The default constructor CodonPair() uses the E. coli.

Then calculate the codon pair score for a provided sequence with CodonPair.cpb which returns a dictionary with the

  • total codon pair score total_cps - the sum of the values of each codon pair
  • the number of codons n_pair - excluding codon pairs not found in the reference
  • the codon pair bias cpb - total_cps/n_pair

For one-off calculations, codonpair.calc_cpb can be used directly for with the sequence of interest (calling the default constructor under the hood).

import codonpair
cp = codonpair.CodonPair.from_named_reference('E. coli')
cp.cpb("ATGATCCCCTTACAACATGGACTGATCCTCGCGGCAATCTTATTCGTTCTTGGCTTAACC")

For convenience, the executable cps installed into the path by pip:

cps test.fasta > test.scores.txt

See CodonPair.write_reference to write codon pair counts for a reference set to the filename provided to be used with future calculations.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

codonpair-0.1.1.tar.gz (6.4 kB view details)

Uploaded Source

File details

Details for the file codonpair-0.1.1.tar.gz.

File metadata

  • Download URL: codonpair-0.1.1.tar.gz
  • Upload date:
  • Size: 6.4 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.1.1 pkginfo/1.5.0.1 requests/2.23.0 setuptools/45.2.0 requests-toolbelt/0.9.1 tqdm/4.43.0 CPython/3.6.7

File hashes

Hashes for codonpair-0.1.1.tar.gz
Algorithm Hash digest
SHA256 7b4b9f061fa4ebd2561f78f726c5a5fedfd379437f373f98289bb264dcf3f628
MD5 89808d109e0beba0ef197138154ecfcf
BLAKE2b-256 06ac54357353ed996e126bb5a66d42221d45c35cb13edf5267a2b328622343bc

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page