A Python implementation to calculate codon pair score
Project description
codonpair
codonpair
calculates codon pair score and codon pair bias. CPS
values are identical to those produced by the perl script from
Dimitris Papamichail (cps_perl
directory) and, presumably,
used in the following work:
Virus attenuation by genome-scale changes in codon pair bias.
Coleman JR1, Papamichail D, Skiena S, Futcher B, Wimmer E, Mueller S.
Science. 2008 Jun 27;320(5884):1784-7. doi: 10.1126/science.1155761.
https://www.ncbi.nlm.nih.gov/pubmed/18583614
Installation
Either, clone the repo and install with pip
git clone git@github.com:smsaladi/codonpair.git pip install ./codonpair
Or... have pip handle the details:
pip install git+git://github.com/smsaladi/codonpair@master#codonpair
All dependencies should be checked for and, if necessary, installed
automatically by pip
.
Usage
Initialize a codonpair.CodonPair
object by specifying a list of reference sequences
CodonPair.from_sequences
, from a named reference CodonPair.from_named_reference
,
a reference file CodonPair.from_reference_file
,
or simply providing a pd.DataFrame
with codon counts to CodonPair
.
The following named references are recognized/bundled with this package.
E. coli
(BL21 DE3)S. pneumoniae
(TIGR4)cps_perl
- the reference file provided with the perl implementation
The default constructor CodonPair()
uses the E. coli
.
Then calculate the codon pair score for a provided sequence with CodonPair.cpb
which returns a dictionary with the
- total codon pair score
total_cps
- the sum of the values of each codon pair - the number of codons
n_pair
- excluding codon pairs not found in the reference - the codon pair bias
cpb
-total_cps/n_pair
For one-off calculations, codonpair.calc_cpb
can be used directly
for with the sequence of interest (calling the default constructor under the hood).
import codonpair cp = codonpair.CodonPair.from_named_reference('E. coli') cp.cpb("ATGATCCCCTTACAACATGGACTGATCCTCGCGGCAATCTTATTCGTTCTTGGCTTAACC")
For convenience, the executable cps
installed into the path by pip:
cps test.fasta > test.scores.txt
See CodonPair.write_reference
to write codon pair counts for a reference set to
the filename provided to be used with future calculations.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.