CRISPRbact
Tools to design and analyse CRISPRi experiments in bacteria.
CRISPRbact is a Python library and command-line tool for designing CRISPRi (CRISPR interference) experiments with the Streptococcus pyogenes dCas9 protein in bacteria.
Features
- On-target activity prediction — predicts how effectively each guide RNA will block gene expression, using a linear model trained on ~92,000 guides in E. coli
- Genome-wide library design — designs optimized CRISPRi libraries for any bacterial genome, selecting the best guides per gene while avoiding off-targets and toxic seed sequences
- Library mapping — evaluates an existing guide library against a new genome to assess coverage and predict activity
- Add-on library design — supplements an existing library (e.g. a core-genome library) with strain-specific guides to achieve full gene coverage
- Core-genome library design — designs guide libraries targeting genes conserved across multiple strains, enabling cross-strain CRISPRi screens
Installation
pip install crisprbact
Quick example
from crisprbact import on_target_predict
guides = on_target_predict("ACCACTGGCGTGCGCGTTACTCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTGTTTGCCGCGCGCGTGGCGAAGGCCCGTGATGAAGGAAAAGTTTTGCGCTATGTTGGCAATATTGATGAAG")
for g in guides:
print(g["guide"], round(g["pred"], 2))
Documentation
Full documentation (guides, API reference, output formats): https://dbikard.pages.pasteur.fr/crisprbact/
References
- Calvo-Villamañán, Wong Ng et al., "On-target activity predictions enable improved CRISPR–dCas9 screens in bacteria", Nucleic Acids Research, 2020, 48(11):e64 (doi:10.1093/nar/gkaa294)
- Rousset F et al., "The impact of genetic diversity on gene essentiality within the Escherichia coli species." Nature Microbiology 6, 301–312 (2021) (doi:10.1038/s41564-020-00839-y)
- Rostain et al., "Cas9 off-target bindings as a source of far-reaching transcriptional noise", Nucleic Acids Research, 2023 (doi:10.1093/nar/gkad170)
1 maintainer
Metadata
1 maintainer
Release files for crisprbact 1.4.1
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| crisprbact-1.4.1.tar.gz | 271.7 kB | Details |
Built distribution (wheel)
| File | Interpreter | ABI | Platform | Reset |
|---|---|---|---|---|
| crisprbact-1.4.1-py3-none-any.whl | Python 3 | none | any | Details |
Total release size: 350.7 kB
Release files / crisprbact-1.4.1.tar.gz
| Download URL | crisprbact-1.4.1.tar.gz |
|---|---|
| Size | 271.7 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
ccdd268519cb2e5e29caa96e03233583ccff49e07c299b9600d87cd4bd6b5a7e
|
|
BLAKE2b-256 checksum How to use checksums |
c49f3458b6c4b87cd837a66fca13a8a18d5c1b043c558a106f4f4360bbe8dfe4
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
uv/0.11.23 {"installer":{"name":"uv","version":"0.11.23","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Debian GNU/Linux","version":"13","id":"trixie","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}
|
Release files / crisprbact-1.4.1-py3-none-any.whl
| Download URL | crisprbact-1.4.1-py3-none-any.whl |
|---|---|
| Size | 79.0 kB |
| Tags | Python 3 |
|
SHA-256 checksum How to use checksums |
1d5fd9e76a1a233e032b9180000723ab7b5c0fa03cf5c35f985878b2bf49accf
|
|
BLAKE2b-256 checksum How to use checksums |
36ac609247d9be0348ec897616b0f929c82703fca9edc54d9331887531bcf1bc
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
uv/0.11.23 {"installer":{"name":"uv","version":"0.11.23","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Debian GNU/Linux","version":"13","id":"trixie","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}
|
