Skip to main content

A packagees into DNA, RNA or protein sequences.

Project description

crockode

crockode is a python package for encoding a string message into a DNA sequence and decoding .

Installation

$ pip install crockode

Usage

import crockode

# returns 'GCCAGCGGGCTAGCTAGCTT'
crockode.encode_string('hello')

# returns 'hello'
crockode.decode_DNA('GCCAGCGGGCTAGCTAGCTT')

Contributing

Interested in contributing? Check out the contributing guidelines. Please note that this project is released with a Code of Conduct. By contributing to this project, you agree to abide by its terms.

License

crockode was created by Michela Palamin, Simone Procaccia, Erin Chung, Joshua Talks. It is licensed under the terms of the MIT license.

Credits

crockode was created with cookiecutter and the py-pkgs-cookiecutter template.

Project status

The creators have run out of time, energy, and motivation to develop this project. Rest In Peace crockode 05/02/2024-09/02/2024.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

crockode-0.1.1.tar.gz (2.9 kB view hashes)

Uploaded Source

Built Distribution

crockode-0.1.1-py3-none-any.whl (3.7 kB view hashes)

Uploaded Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page