DNA analyser API wrapper tool for Jupiter notebooks.
Project description
Tool for creating R-loop tracker, P53predictor, G4Killer and G4Hunter analysis. Work as API wrapper for IBP DNA analyzer API bioinformatics.ibp. Currently working with an instance of DNA analyser server running on http://bioinformatics.ibp.cz computational core but can be switched to the local instance of the server.
Getting Started
Prerequisites
python >= 3.6
Installing
To install test version from Pypi.
pipenv install dna-analyser-ibp
pip install dna-analyser-ibp
Documentation
Methods are documented in the following documentation.
Quick start
DNA analyser uses pandas.Dataframe
or pandas.Series
. Firstly the user has to create Api
object and login to API.
from DNA_analyser_IBP.api import Api API = Api()
Enter your email example@example.cz Enter your password ········ 2020-09-16 18:51:17.943398 [INFO]: User host is trying to login ... 2020-09-16 18:51:17.990580 [INFO]: User host is successfully loged in ...
If DNA analyser API server is not running on http://bioinformatics.ibp.cz then you have to set server paramether to create Api
object.
from DNA_analyser_IBP.api import Api API = Api( server='http://hostname:port/api' )
Sequence uploading
Sequences can be uploaded from NCBI, plain text or text file. Example bellow illustrates NCBI sequence uploading Homo sapiens chromosome 12
.
API.sequence.ncbi_creator( circular= True, tags=['Homo','sapiens', 'chromosome'], name='Homo sapiens chromosome 12', ncbi_id='NC_000012.12' ) API.sequence.load_all( tags=['Homo'] )
G4Hunter
G4Hunter is a tool for prediction of G-quadruplex propensity in nucleic acids, this algorithm considers G-richness and G-skewness of a tested sequence and shows a quadruplex propensity score.
sapiens = API.g4hunter.load_all( tags=['Homo'] ) API.g4hunter.analyse_creator( sequence=sapiens, tags=['analyse','Homo', 'sapiens'], threshold=1.4, window_size=30 )
To load results of G4Hunter analysis.
API.g4hunter.load_all( tags=['analyse', 'Homo', 'sapiens'] )
R-loop tracker
R-loop tracker is a toll for prediction of R-loops in nucleic acids. The algorithms search for R-loop initiation zone based on presence of G-clusters and R-loop elongation zone containing at least 40% of Guanine density.
sapiens = API.g4hunter.load_all( tags=['Homo'] ) API.rloopr.analyse_creator( sequence=sapiens, tags=['analyse', 'Homo', 'sapiens'], riz_2g_cluster=True, riz_3g_cluster=False )
To load results of R-loop tracker analysis.
API.rloopr.load_all( tags=['analyse', 'Homo', 'sapiens'] )
G4Killer
G4Killer algorithm allows to mutate DNA sequences with desired G4Hunter score with minimal mutation steps.
API.g4killer.run( sequence='AATTATTTGGAAAGGGGGGGTTTTCCGA', threshold=0.5 ) API.g4killer.run_multiple( sequences=[ 'AATTATTTGGAAAGGGGGGGTTTTCCGA', 'AATTATTTGGAAAGGGGGGGTTTTCCGA' ], threshold=0.5 )
P53 predictor
P53 binding predictor for 20 base pairs sequences.
API.p53.run( sequence='GGACATGCCCGGGCATGTCC' ) API.p53.run_multiple( sequences=[ 'GGACATGCCCGGGCATGTCC', 'GGACATGCCCGGGCATGTCC' ] )
Development
Dependencies
- tenacity >= 6.1.0
- requests >= 2.20
- requests-toolbelt >= 0.9.1
- pyjwt >= 1.7.1
- pandas >= 0.23
- matplotlib >= 3.0.3
- tqdm >= 4.28
DEV dependencies
- pytest = "^6.0.2"
- pdoc3 = "^0.9.1"
- black = "^20.0"
Tests
To run tests only when downloaded directly from this repository.
pytest -v tests/
Authors
- Patrik Kaura - Main developer - patrikkaura
- Jan Kolomaznik - Supervisor - jankolomaznik
- Jiří Šťastný - Supervisor
License
This project is licensed under the GPL-3.0 License - see the LICENSE.md file for details.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Filename, size | File type | Python version | Upload date | Hashes |
---|---|---|---|---|
Filename, size DNA_analyser_IBP-3.3.2-py3-none-any.whl (55.6 kB) | File type Wheel | Python version py3 | Upload date | Hashes View |
Filename, size DNA_analyser_IBP-3.3.2.tar.gz (36.6 kB) | File type Source | Python version None | Upload date | Hashes View |
Hashes for DNA_analyser_IBP-3.3.2-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | ad3aa82604aa4fcde42aa119c38ec1771e12943f6107ede82c983434f4f5e046 |
|
MD5 | fb14b77d2bfca4dd13161d16b43daf1a |
|
BLAKE2-256 | 17498a638f5642070228211946563c4b183bd246300e945bedfaef41ddf114e7 |