dna-analyser-ibp 1.5

DNA analyser API wrapper tool for Jupiter notebooks.

DNA analyser IBP

Tool for creating palindrome, p53, and G-quadruplex analysis. Work as API wrapper for IBP DNA analyzer API bioinformatics.ibp. Currently working with localhost instance of DNA analyser server working on http://bioinformatics.ibp.cz computational core but can be switched to local instance of server.

Getting Started

Prerequisites

python >= 3.6

Dependencies

• requests >= 2.20
• requests-toolbelt >= 0.9.1
• pyjwt >= 1.7.1
• pandas >= 0.23
• matplotlib >= 3.0.3
• tqdm >= 4.28

Features

• g4hunter analyser - version 1.0
• g4killer analyser - version 1.1
• g4hunter heatmap - version 1.3
• p53 predictor tool - version 1.4
• new documentation minor fixes - version 1.5
• palindrome analyser
• feature map overlaping

Installing

To install test version from Pypi.

pipenv install dna-analyser-ibp

pip install dna-analyser-ibp

Quick start

DNA analyser uses pandas dataframe or pandas series. Firstly the user has to create Api object and login to API.

from DNA_analyser_IBP.api import Api

API = Api()

Enter your email        [e-mail]
Enter your password     ········
User [e-mail] logged in: 2019-03-27 19:46:56.661376

If DNA analyser API server not running on http://bioinformatics.ibp.cz then use this example to create Api object.

from DNA_analyser_IBP.api import Api

API = Api(server='http://hostname:port/api')

Then upload NCBI sequence for example Homo sapiens chromosome 12 use.

API.sequence.ncbi_creator(circular= True, tags=['Homo','sapiens', 'chromosome'], name='Homo sapiens chromosome 12', ncbi_id='NC_000012.12')

To analyse NCBI sequence use g4hunter interface.

sapiens_sequence = API.sequence.load_all(filter_tag='Homo') # get series with sapiens sequence

# run g4hunter analyses with these params
API.g4hunter.analyse_creator(sequence=sapiens_sequence, tags=['testovaci','Homo', 'sapiens'], threshold=1.4, window_size=30)

Last step to see results of g4hunter analysis.

sapiens = API.g4hunter.load_all(filter_tag=['Homo']) # returns dataframe
API.g4hunter.load_results(g4hunter_analyse=sapiens.iloc[0]) # iloc[0] to select row from dataframe

P53 / G4KILLER TOOL

To run simple tools using plain text input.

# implements g4killer algorithm for generating sequence with lower gscore
API.g4killer.analyse_creator(origin_sequence='AATTATTTGGAAAGGGGGGGTTTTCCGA', threshold=0.5) 

# implements calculations of p53 binding predictor for 20 base pairs sequences 
API.p53.analyse_creator(sequence='GGACATGCCCGGGCATGTCC') 

Tests

To run tests only when downloaded directly from this repository.

pytest -v tests/

Authors

• Patrik Kaura - Main developer - patrikkaura
• Josef Havranek - Developer
• Jan Kolomaznik - Supervisor - jankolomaznik

License

This project is licensed under the GPL-3.0 License - see the LICENSE.md file for details