DNA analyser API wrapper tool for Jupiter notebooks.
Project description
DNA analyser IBP
Tool for creating Palindrome, P53predictor, and G4Hunter analysis. Work as API wrapper for IBP DNA analyzer API bioinformatics.ibp. Currently working with an instance of DNA analyser server running on http://bioinformatics.ibp.cz computational core but can be switched to the local instance of the server.
Getting Started
Prerequisites
python >= 3.6
Installing
To install test version from Pypi.
pipenv install dna-analyser-ibp
pip install dna-analyser-ibp
Documentation
Methods are documented in the following documentation.
Quick start
DNA analyser uses pandas.Dataframe
or pandas.Series
. Firstly the user has to create Api
object and login to API.
from DNA_analyser_IBP.api import Api
API = Api()
Enter your email example@example.cz
Enter your password ········
2020-09-16 18:51:17.943398 [INFO]: User host is trying to login ...
2020-09-16 18:51:17.990580 [INFO]: User host is successfully loged in ...
If DNA analyser API server not running on http://bioinformatics.ibp.cz then use this example to create Api
object.
from DNA_analyser_IBP.api import Api
API = Api(server='http://hostname:port/api')
Then upload NCBI sequence for example Homo sapiens chromosome 12
use.
API.sequence.ncbi_creator(circular= True, tags=['Homo','sapiens', 'chromosome'], name='Homo sapiens chromosome 12', ncbi_id='NC_000012.12')
To analyse NCBI sequence use g4hunter interface.
sapiens_sequence = API.sequence.load_all(tags='Homo') # get series with sapiens sequence
# run g4hunter analyses with these params
API.g4hunter.analyse_creator(sequence=sapiens_sequence, tags=['testovaci','Homo', 'sapiens'], threshold=1.4, window_size=30)
Last step to see results of g4hunter analysis.
sapiens = API.g4hunter.load_all(tags=['Homo']) # returns dataframe
API.g4hunter.load_results(analyse=sapiens.iloc[0]) # iloc[0] to select row from dataframe
P53 / G4KILLER TOOL
To run simple tools using plain text input.
# implements g4killer algorithm for generating sequence with lower gscore
API.g4killer.run(sequence='AATTATTTGGAAAGGGGGGGTTTTCCGA', threshold=0.5)
# implements calculations of p53 binding predictor for 20 base pairs sequences
API.p53.run(sequence='GGACATGCCCGGGCATGTCC')
Development
Dependencies
- tenacity >= 6.1.0
- requests >= 2.20
- requests-toolbelt >= 0.9.1
- pyjwt >= 1.7.1
- pandas >= 0.23
- matplotlib >= 3.0.3
- tqdm >= 4.28
Tests
To run tests only when downloaded directly from this repository.
pytest -v tests/
Authors
- Patrik Kaura - Main developer - patrikkaura
- Jan Kolomaznik - Supervisor - jankolomaznik
- Jiří Šťastný - Supervisor
License
This project is licensed under the GPL-3.0 License - see the LICENSE.md file for details.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Hashes for DNA_analyser_IBP-3.0.0-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | c4c83b05fee8b287967d27affaa9050c4729ad109524ffb7e5b22103bdeb844c |
|
MD5 | ca737505d1a004cc19f0647807a6ce44 |
|
BLAKE2b-256 | 0ec5b9b8545a815caf46094e0a83b8118aaeaaa47d61879ebd1cf7cfcf7937e2 |