edittag 1.1

Design and check sets of edit metric sequence tags.

Copyright (c) 2009-2012 Brant C. Faircloth. All rights reserved.

• See LICENSE.md for standard computer code.

• Sequence tags available from https://github.com/faircloth-lab/edittag/downloads are licensed under Creative Commons Attribution 3.0 United States License.

Description

edittag is a software collection for designing sets of edit metric sequence tags, checking sequence tags for conformation to the edit metric, and integrating sequence tags to platform-specific sequencing adapters and PCR primers. edittag differs from other approaches:

• edittag generates arbitrary lengths of edit-metric sequence tags in reasonable time frames using multiprocessing

• edittag produces edit metric sequence tag sets conform to the edit distance selected

• edittag used primer3 to integrate sequence tags to PCR primers

We provide several large sets of edit metric sequence tags designed using edittag in the following formats:

• text - this file is in an appropriate format for check_levenshtien_distance.py

• csv

• sqlite database

Documentation

You can find documentation here:

http://faircloth-lab.github.com/edittag/

Citation

Faircloth BC, Glenn TC. Large sets of edit-metric sequence identification tags to facilitate large-scale multiplexing of reads from massively parallel sequencing. http://precedings.nature.com/documents/5672/version/1

Dependencies

• Python 2.7.x (should work on 2.6.x)

• numpy (tested with 1.5.1)

• py-levenshtein [optional - strongly recommended]

• mod-primer3 [optional - needed for amplicon tagging]

• nose [optional - for unittests]

Availability

• tar.gz

• repository

Installation

easy_install

easy_install edittag

tar.gz

wget package.tar.gz
tar -xzf package.tar.gz
python setup.py install

repository

git clone git://github.com/faircloth-lab/edittag.git edittag

optional package (py-levenshtein)

wget http://pylevenshtein.googlecode.com/files/python-Levenshtein-0.10.1.tar.bz2
tar -xzvf python-Levenshtein-0.10.1.tar.bz2
python setup.py install

optional package (primer3)

If you wish to design primers incorporating edit metric sequence tags, you need to first install a modified version of primer3::

git clone git://github.com/baddna/mod-primer3.git
cd mod-primer3/src
make

Ensure that you move the binaries from mod-primer3 to a location in your path (move at least primer3-long and primer3_config into identical directories in your path).

Testing

# Testing requires numpy and nose
import edittag
edittag.test()

Using edittag

# generate some tags
% design_edit_metric_tags.py --tag-length=6 --edit-distance=3 \
    --no-polybase --gc --comp --min-and-greater --output tmp/tags.txt

# validate the 6 nucleotide, edit distance 3 tag set
% validate_edit_metric_tags.py
    --input=tmp/tags.txt
    --section='6nt ed3'
    --verbose

# add those tags to a primer set
% add_tags_to_primers.py --left-primer=GTTATGCATGAACGTAATGCTC
    --right-primer=CGCGCATGGTGGATTCACAATCC \
    --input tmp/tags.txt --section='6nt ed3'
    --sort=pair_hairpin_either,pair_penalty,cycles \
    --remove-common --keep-database \
    --output tmp/trnH_tagged_with_10_nt_ed_5_tags.csv