Skip to main content
This is a pre-production deployment of Warehouse. Changes made here affect the production instance of PyPI (pypi.python.org).
Help us improve Python packaging - Donate today!

Design and check sets of edit metric sequence tags.

Project Description

Copyright (c) 2009-2012 Brant C. Faircloth. All rights reserved.

Description

edittag is a software collection for designing sets of edit metric sequence tags, checking sequence tags for conformation to the edit metric, and integrating sequence tags to platform-specific sequencing adapters and PCR primers. edittag differs from other approaches:

  • edittag generates arbitrary lengths of edit-metric sequence tags in reasonable time frames using multiprocessing
  • edittag produces edit metric sequence tag sets conform to the edit distance selected
  • edittag used primer3 to integrate sequence tags to PCR primers

We provide several large sets of edit metric sequence tags designed using edittag in the following formats:

Documentation

You can find documentation here:

http://faircloth-lab.github.com/edittag/

Citation

Faircloth BC, Glenn TC. Large sets of edit-metric sequence identification tags to facilitate large-scale multiplexing of reads from massively parallel sequencing. http://precedings.nature.com/documents/5672/version/1

Dependencies

Availability

  • tar.gz
  • repository

Installation

easy_install

easy_install edittag

tar.gz

wget package.tar.gz
tar -xzf package.tar.gz
python setup.py install

repository

git clone git://github.com/faircloth-lab/edittag.git edittag

optional package (py-levenshtein)

wget http://pylevenshtein.googlecode.com/files/python-Levenshtein-0.10.1.tar.bz2
tar -xzvf python-Levenshtein-0.10.1.tar.bz2
python setup.py install

optional package (primer3)

If you wish to design primers incorporating edit metric sequence tags, you need to first install a modified version of primer3::

git clone git://github.com/baddna/mod-primer3.git
cd mod-primer3/src
make

Ensure that you move the binaries from mod-primer3 to a location in your path (move at least primer3-long and primer3_config into identical directories in your path).

Testing

# Testing requires numpy and nose
import edittag
edittag.test()

Using edittag

# generate some tags
% design_edit_metric_tags.py --tag-length=6 --edit-distance=3 \
    --no-polybase --gc --comp --min-and-greater --output tmp/tags.txt

# validate the 6 nucleotide, edit distance 3 tag set
% validate_edit_metric_tags.py
    --input=tmp/tags.txt
    --section='6nt ed3'
    --verbose

# add those tags to a primer set
% add_tags_to_primers.py --left-primer=GTTATGCATGAACGTAATGCTC
    --right-primer=CGCGCATGGTGGATTCACAATCC \
    --input tmp/tags.txt --section='6nt ed3'
    --sort=pair_hairpin_either,pair_penalty,cycles \
    --remove-common --keep-database \
    --output tmp/trnH_tagged_with_10_nt_ed_5_tags.csv
Release History

Release History

This version
History Node

1.1

History Node

1.0

Download Files

Download Files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
edittag-1.1.tar.gz (108.1 kB) Copy SHA256 Checksum SHA256 Source Jul 13, 2012

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting