Find and classify tetrads and quadruplexes in DNA/RNA 3D structure
Project description
Project description
This is an application to analyze base pairing patterns of DNA/RNA 3D structures to find and classify tetrads and quadruplexes. ElTetrado assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the directionality of the tetrad (+/-) determined by the bonds between bases and their non-canonical interactions. The interactions follow Leontis/Westhof classification (Leontis et al. 2001). Watson-Crick (W) edge of first base in the tetrad structure exposed to the Hoogsteen (H) edge of the next nucleobase from the same tetrad sets the tetrad directionality, clockwise (+) or anticlockwise (-). For more details, please refer to Zok et al. (2020) and Popenda et al. (2020)
Installation
Please run:
pip install eltetrado
If you have both Python 2 and Python 3 installed, you need to explicitly
call pip3
:
pip3 install eltetrado
Dependencies
The project is written in Python 3.6+ and requires mmcif, orjson, NumPy and requests.
Visualization is created by R
3.6+ script which uses
R4RNA (Lai et al. 2012) library. The
dependency will be automatically installed if not present.
Usage
ElTetrado is a command line application, which requires to be provided
with --input
and a path to a PDB or PDBx/mmCIF file.
By default, ElTetrado outputs textual results on the standard output. A
JSON version of the output can be obtained with --output
switch
followed by a path where the file is supposed to be created.
ElTetrado prepares visualization of the whole structure and of each
N4-helices, quadruplexes and tetrads. This can be supplemented with
canonical base pairs visualization when --complete-2d
is set. All
color settings are located in the first several lines of the quadraw.R
file, you can easily change them without knowledge of R language. If you
want ElTetrado to not visualize anything, pass --no-image
switch to
it.
usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL]
[--stacking-mismatch STACKING_MISMATCH] [--strict]
[--no-reorder] [--complete-2d] [--no-image] [--version]
options:
-h, --help show this help message and exit
-i INPUT, --input INPUT
path to input PDB or PDBx/mmCIF file
-o OUTPUT, --output OUTPUT
(optional) path for output JSON file
-m MODEL, --model MODEL
(optional) model number to process
--stacking-mismatch STACKING_MISMATCH
a perfect tetrad stacking covers 4 nucleotides; this
option can be used with value 1 or 2 to allow this
number of nucleotides to be non-stacked with otherwise
well aligned tetrad [default=2]
--strict nucleotides in tetrad are found when linked only by
cWH pairing
--no-reorder chains of bi- and tetramolecular quadruplexes should
be reordered to be able to have them classified; when
this is set, chains will be processed in original
order, which for bi-/tetramolecular means that they
will likely be misclassified; use with care!
--complete-2d when set, the visualization will also show canonical
base pairs to provide context for the quadruplex
--no-image when set, the visualization will not be created at all
--version show program's version number and exit
Chains reorder
ElTetrado keeps a global and unique 5’-3’ index for every nucleotide which is independent from residue numbers. For example, if a structure has chain M with 60 nucleotides and chain N with 15 nucleotides, then ElTetrado will keep index between 0 and 74 which uniquely identifies every nucleotide. Initially, ElTetrado assigns this indices according to the order of chains in the input file. Therefore, if M preceded N then nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74. Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from 15 to 74.
When --no-reorder
is present, this initial assignment is used.
Otherwise, ElTetrado exhaustively checks all permutations of chains’
orders. Every permutation check induces recalculation of the global and
unique 5’-3’ index and in effect it changes ONZ classification of
tetrads.
ElTetrado keeps a table of tetrad classification scores according to these rules:
- Type preference:
O
>N
>Z
- Direction preference:
+
>-
The table keeps low values for preferred classes i.e. O+
is 0, O-
is
1 and so on up to Z-
with score 5. For every permutation of chain
orders, ElTetrado computes sum of scores for tetrads classification
induced by 5’-3’ indexing. We select permutation with the minimum value.
Examples
2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form
$ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif
$ ./eltetrado --input 2hy9.cif --output 2hy9.json
Chain order: 1
n4-helix with 3 tetrads
Oh* V,VI 9a -(pll) quadruplex with 3 tetrads
1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17
direction=hybrid rise=3.21 twist=16.23
1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1
direction=hybrid rise=3.11 twist=27.45
1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18
Tracts:
1.DG4, 1.DG5, 1.DG6
1.DG22, 1.DG23, 1.DG24
1.DG18, 1.DG17, 1.DG16
1.DG10, 1.DG11, 1.DG12
Loops:
propeller- 1.DT7, 1.DT8, 1.DA9
lateral- 1.DT13, 1.DT14, 1.DA15
lateral+ 1.DT19, 1.DT20, 1.DA21
AAAGGGTTAGGGTTAGGGTTAGGGAA
...([{...(((...)))...)]}..
...([{...)]}...(((...)))..
Click to see the output JSON
{
"metals": [],
"nucleotides": [
{
"index": 1,
"chain": "1",
"number": 1,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA1",
"shortName": "A",
"chi": 22.308282830857802,
"glycosidicBond": "syn"
},
{
"index": 2,
"chain": "1",
"number": 2,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA2",
"shortName": "A",
"chi": -123.05454402191421,
"glycosidicBond": "anti"
},
{
"index": 3,
"chain": "1",
"number": 3,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA3",
"shortName": "A",
"chi": -94.96579955603106,
"glycosidicBond": "anti"
},
{
"index": 4,
"chain": "1",
"number": 4,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG4",
"shortName": "G",
"chi": 79.28363721639316,
"glycosidicBond": "syn"
},
{
"index": 5,
"chain": "1",
"number": 5,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG5",
"shortName": "G",
"chi": -126.01709201555563,
"glycosidicBond": "anti"
},
{
"index": 6,
"chain": "1",
"number": 6,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG6",
"shortName": "G",
"chi": -127.26656202302102,
"glycosidicBond": "anti"
},
{
"index": 7,
"chain": "1",
"number": 7,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT7",
"shortName": "T",
"chi": -63.10830751967371,
"glycosidicBond": "syn"
},
{
"index": 8,
"chain": "1",
"number": 8,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT8",
"shortName": "T",
"chi": -138.79520345559828,
"glycosidicBond": "anti"
},
{
"index": 9,
"chain": "1",
"number": 9,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA9",
"shortName": "A",
"chi": -148.83990757408878,
"glycosidicBond": "anti"
},
{
"index": 10,
"chain": "1",
"number": 10,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG10",
"shortName": "G",
"chi": 58.7787525019158,
"glycosidicBond": "syn"
},
{
"index": 11,
"chain": "1",
"number": 11,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG11",
"shortName": "G",
"chi": -123.85746807924986,
"glycosidicBond": "anti"
},
{
"index": 12,
"chain": "1",
"number": 12,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG12",
"shortName": "G",
"chi": -84.36679807284759,
"glycosidicBond": "syn"
},
{
"index": 13,
"chain": "1",
"number": 13,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT13",
"shortName": "T",
"chi": -30.819029132834157,
"glycosidicBond": "syn"
},
{
"index": 14,
"chain": "1",
"number": 14,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT14",
"shortName": "T",
"chi": -168.51776782812965,
"glycosidicBond": "anti"
},
{
"index": 15,
"chain": "1",
"number": 15,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA15",
"shortName": "A",
"chi": -105.72881577106517,
"glycosidicBond": "anti"
},
{
"index": 16,
"chain": "1",
"number": 16,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG16",
"shortName": "G",
"chi": 74.3227942181243,
"glycosidicBond": "syn"
},
{
"index": 17,
"chain": "1",
"number": 17,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG17",
"shortName": "G",
"chi": 81.08424926936044,
"glycosidicBond": "syn"
},
{
"index": 18,
"chain": "1",
"number": 18,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG18",
"shortName": "G",
"chi": -122.90397217111551,
"glycosidicBond": "anti"
},
{
"index": 19,
"chain": "1",
"number": 19,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT19",
"shortName": "T",
"chi": -102.98239337113938,
"glycosidicBond": "anti"
},
{
"index": 20,
"chain": "1",
"number": 20,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT20",
"shortName": "T",
"chi": -112.1514601849715,
"glycosidicBond": "anti"
},
{
"index": 21,
"chain": "1",
"number": 21,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA21",
"shortName": "A",
"chi": -89.07113063649612,
"glycosidicBond": "syn"
},
{
"index": 22,
"chain": "1",
"number": 22,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG22",
"shortName": "G",
"chi": 83.44318693001902,
"glycosidicBond": "syn"
},
{
"index": 23,
"chain": "1",
"number": 23,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG23",
"shortName": "G",
"chi": -115.41210237198398,
"glycosidicBond": "anti"
},
{
"index": 24,
"chain": "1",
"number": 24,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG24",
"shortName": "G",
"chi": -111.14845782593531,
"glycosidicBond": "anti"
},
{
"index": 25,
"chain": "1",
"number": 25,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA25",
"shortName": "A",
"chi": -58.323530637551954,
"glycosidicBond": "syn"
},
{
"index": 26,
"chain": "1",
"number": 26,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA26",
"shortName": "A",
"chi": -90.84065243137135,
"glycosidicBond": "anti"
}
],
"basePairs": [
{
"nt1": "1.DA3",
"nt2": "1.DA9",
"lw": "tSW"
},
{
"nt1": "1.DG4",
"nt2": "1.DG10",
"lw": "cHW"
},
{
"nt1": "1.DG4",
"nt2": "1.DG22",
"lw": "cWH"
},
{
"nt1": "1.DG5",
"nt2": "1.DG11",
"lw": "cWH"
},
{
"nt1": "1.DG5",
"nt2": "1.DG23",
"lw": "cHW"
},
{
"nt1": "1.DG6",
"nt2": "1.DG12",
"lw": "cWH"
},
{
"nt1": "1.DG6",
"nt2": "1.DG24",
"lw": "cHW"
},
{
"nt1": "1.DA9",
"nt2": "1.DA3",
"lw": "tWS"
},
{
"nt1": "1.DG10",
"nt2": "1.DG4",
"lw": "cWH"
},
{
"nt1": "1.DG10",
"nt2": "1.DG18",
"lw": "cHW"
},
{
"nt1": "1.DG11",
"nt2": "1.DG5",
"lw": "cHW"
},
{
"nt1": "1.DG11",
"nt2": "1.DG17",
"lw": "cWH"
},
{
"nt1": "1.DG12",
"nt2": "1.DG6",
"lw": "cHW"
},
{
"nt1": "1.DG12",
"nt2": "1.DG16",
"lw": "cWH"
},
{
"nt1": "1.DT14",
"nt2": "1.DA25",
"lw": "tWW"
},
{
"nt1": "1.DG16",
"nt2": "1.DG12",
"lw": "cHW"
},
{
"nt1": "1.DG16",
"nt2": "1.DG24",
"lw": "cWH"
},
{
"nt1": "1.DG17",
"nt2": "1.DG11",
"lw": "cHW"
},
{
"nt1": "1.DG17",
"nt2": "1.DG23",
"lw": "cWH"
},
{
"nt1": "1.DG18",
"nt2": "1.DG10",
"lw": "cWH"
},
{
"nt1": "1.DG18",
"nt2": "1.DG22",
"lw": "cHW"
},
{
"nt1": "1.DG22",
"nt2": "1.DG4",
"lw": "cHW"
},
{
"nt1": "1.DG22",
"nt2": "1.DG18",
"lw": "cWH"
},
{
"nt1": "1.DG23",
"nt2": "1.DG5",
"lw": "cWH"
},
{
"nt1": "1.DG23",
"nt2": "1.DG17",
"lw": "cHW"
},
{
"nt1": "1.DG24",
"nt2": "1.DG6",
"lw": "cWH"
},
{
"nt1": "1.DG24",
"nt2": "1.DG16",
"lw": "cHW"
},
{
"nt1": "1.DA25",
"nt2": "1.DT14",
"lw": "tWW"
}
],
"helices": [
{
"quadruplexes": [
{
"tetrads": [
{
"id": "1.DG4-1.DG22-1.DG18-1.DG10",
"nt1": "1.DG4",
"nt2": "1.DG22",
"nt3": "1.DG18",
"nt4": "1.DG10",
"onz": "O-",
"gbaClassification": "Vb",
"planarityDeviation": 0.17372283960377805,
"ionsChannel": [],
"ionsOutside": []
},
{
"id": "1.DG5-1.DG23-1.DG17-1.DG11",
"nt1": "1.DG5",
"nt2": "1.DG23",
"nt3": "1.DG17",
"nt4": "1.DG11",
"onz": "O+",
"gbaClassification": "Va",
"planarityDeviation": 0.10474313820007483,
"ionsChannel": [],
"ionsOutside": []
},
{
"id": "1.DG6-1.DG24-1.DG16-1.DG12",
"nt1": "1.DG6",
"nt2": "1.DG24",
"nt3": "1.DG16",
"nt4": "1.DG12",
"onz": "O+",
"gbaClassification": "VIa",
"planarityDeviation": 0.18293509778060615,
"ionsChannel": [],
"ionsOutside": []
}
],
"onzm": "Oh*",
"loopClassification": {
"classification": "9a",
"loop_progression": "-(pll)"
},
"gbaClassification": [
"V",
"VI"
],
"tracts": [
[
"1.DG4",
"1.DG5",
"1.DG6"
],
[
"1.DG22",
"1.DG23",
"1.DG24"
],
[
"1.DG18",
"1.DG17",
"1.DG16"
],
[
"1.DG10",
"1.DG11",
"1.DG12"
]
],
"loops": [
{
"type": "propeller-",
"nucleotides": [
"1.DT7",
"1.DT8",
"1.DA9"
]
},
{
"type": "lateral-",
"nucleotides": [
"1.DT13",
"1.DT14",
"1.DA15"
]
},
{
"type": "lateral+",
"nucleotides": [
"1.DT19",
"1.DT20",
"1.DA21"
]
}
]
}
],
"tetradPairs": [
{
"tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10",
"tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11",
"direction": "hybrid",
"rise": 3.2109650905140654,
"twist": 16.228973729066034
},
{
"tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11",
"tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12",
"direction": "hybrid",
"rise": 3.1149939255558747,
"twist": 27.448958336697046
}
]
}
],
"dotBracket": {
"sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
"line1": "...([{...(((...)))...)]}..",
"line2": "...([{...)]}...(((...))).."
}
}
4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions
$ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif
$ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json
Chain order: A AB AA AC B BC BA BB
n4-helix with 10 tetrads
Op* VIII n/a quadruplex with 5 tetrads
A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
direction=parallel rise=3.37 twist=39.96
A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8
direction=parallel rise=3.31 twist=25.9
A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR
direction=parallel rise=3.34 twist=35.81
A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR
direction=parallel rise=3.29 twist=27.12
A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54 ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA]
Tracts:
A.U1006, A.G1005, A.G1004, A.G1003, A.G1002
AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002
AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002
AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002
Op* VIII n/a quadruplex with 5 tetrads
B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67
direction=parallel rise=3.37 twist=27.41
B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA]
direction=parallel rise=3.32 twist=35.04
B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR
direction=parallel rise=3.27 twist=25.15
B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA
direction=parallel rise=7.14 twist=43.41
B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA
Tracts:
B.G2002, B.G2003, B.G2004, B.G2005, B.U2006
BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006
BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006
BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006
UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU
.([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a
.([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a
Click to see the output JSON
{
"metals": [
{
"symbol": "Sr",
"count": 8
},
{
"symbol": "Na",
"count": 4
},
{
"symbol": "Ca",
"count": 12
}
],
"nucleotides": [
{
"index": 1,
"chain": "A",
"number": 1001,
"icode": null,
"molecule": "RNA",
"fullName": "A.U1001",
"shortName": "U",
"chi": -141.92671313255752,
"glycosidicBond": "anti"
},
{
"index": 2,
"chain": "A",
"number": 1002,
"icode": null,
"molecule": "RNA",
"fullName": "A.G1002",
"shortName": "G",
"chi": -165.93034671112116,
"glycosidicBond": "anti"
},
{
"index": 3,
"chain": "A",
"number": 1003,
"icode": null,
"molecule": "RNA",
"fullName": "A.G1003",
"shortName": "G",
"chi": -121.5652426033226,
"glycosidicBond": "anti"
},
{
"index": 4,
"chain": "A",
"number": 1004,
"icode": null,
"molecule": "RNA",
"fullName": "A.G1004",
"shortName": "G",
"chi": -156.00957673923344,
"glycosidicBond": "anti"
},
{
"index": 5,
"chain": "A",
"number": 1005,
"icode": null,
"molecule": "RNA",
"fullName": "A.G1005",
"shortName": "G",
"chi": -148.10051684016415,
"glycosidicBond": "anti"
},
{
"index": 6,
"chain": "A",
"number": 1006,
"icode": null,
"molecule": "RNA",
"fullName": "A.U1006",
"shortName": "U",
"chi": -137.28005568139983,
"glycosidicBond": "anti"
},
{
"index": 13,
"chain": "AA",
"number": 1001,
"icode": null,
"molecule": "RNA",
"fullName": "AA.U1001",
"shortName": "U",
"chi": -141.9267131325575,
"glycosidicBond": "anti"
},
{
"index": 14,
"chain": "AA",
"number": 1002,
"icode": null,
"molecule": "RNA",
"fullName": "AA.G1002",
"shortName": "G",
"chi": -165.93034671112113,
"glycosidicBond": "anti"
},
{
"index": 15,
"chain": "AA",
"number": 1003,
"icode": null,
"molecule": "RNA",
"fullName": "AA.G1003",
"shortName": "G",
"chi": -121.56524260332266,
"glycosidicBond": "anti"
},
{
"index": 16,
"chain": "AA",
"number": 1004,
"icode": null,
"molecule": "RNA",
"fullName": "AA.G1004",
"shortName": "G",
"chi": -156.0095767392335,
"glycosidicBond": "anti"
},
{
"index": 17,
"chain": "AA",
"number": 1005,
"icode": null,
"molecule": "RNA",
"fullName": "AA.G1005",
"shortName": "G",
"chi": -148.10051684016406,
"glycosidicBond": "anti"
},
{
"index": 18,
"chain": "AA",
"number": 1006,
"icode": null,
"molecule": "RNA",
"fullName": "AA.U1006",
"shortName": "U",
"chi": -137.2800556813998,
"glycosidicBond": "anti"
},
{
"index": 7,
"chain": "AB",
"number": 1001,
"icode": null,
"molecule": "RNA",
"fullName": "AB.U1001",
"shortName": "U",
"chi": -141.9267131325574,
"glycosidicBond": "anti"
},
{
"index": 8,
"chain": "AB",
"number": 1002,
"icode": null,
"molecule": "RNA",
"fullName": "AB.G1002",
"shortName": "G",
"chi": -165.93034671112113,
"glycosidicBond": "anti"
},
{
"index": 9,
"chain": "AB",
"number": 1003,
"icode": null,
"molecule": "RNA",
"fullName": "AB.G1003",
"shortName": "G",
"chi": -121.56524260332266,
"glycosidicBond": "anti"
},
{
"index": 10,
"chain": "AB",
"number": 1004,
"icode": null,
"molecule": "RNA",
"fullName": "AB.G1004",
"shortName": "G",
"chi": -156.00957673923347,
"glycosidicBond": "anti"
},
{
"index": 11,
"chain": "AB",
"number": 1005,
"icode": null,
"molecule": "RNA",
"fullName": "AB.G1005",
"shortName": "G",
"chi": -148.10051684016406,
"glycosidicBond": "anti"
},
{
"index": 12,
"chain": "AB",
"number": 1006,
"icode": null,
"molecule": "RNA",
"fullName": "AB.U1006",
"shortName": "U",
"chi": -137.28005568139977,
"glycosidicBond": "anti"
},
{
"index": 19,
"chain": "AC",
"number": 1001,
"icode": null,
"molecule": "RNA",
"fullName": "AC.U1001",
"shortName": "U",
"chi": -141.92671313255747,
"glycosidicBond": "anti"
},
{
"index": 20,
"chain": "AC",
"number": 1002,
"icode": null,
"molecule": "RNA",
"fullName": "AC.G1002",
"shortName": "G",
"chi": -165.93034671112116,
"glycosidicBond": "anti"
},
{
"index": 21,
"chain": "AC",
"number": 1003,
"icode": null,
"molecule": "RNA",
"fullName": "AC.G1003",
"shortName": "G",
"chi": -121.56524260332266,
"glycosidicBond": "anti"
},
{
"index": 22,
"chain": "AC",
"number": 1004,
"icode": null,
"molecule": "RNA",
"fullName": "AC.G1004",
"shortName": "G",
"chi": -156.00957673923352,
"glycosidicBond": "anti"
},
{
"index": 23,
"chain": "AC",
"number": 1005,
"icode": null,
"molecule": "RNA",
"fullName": "AC.G1005",
"shortName": "G",
"chi": -148.1005168401641,
"glycosidicBond": "anti"
},
{
"index": 24,
"chain": "AC",
"number": 1006,
"icode": null,
"molecule": "RNA",
"fullName": "AC.U1006",
"shortName": "U",
"chi": -137.28005568139986,
"glycosidicBond": "anti"
},
{
"index": 25,
"chain": "B",
"number": 2001,
"icode": null,
"molecule": "RNA",
"fullName": "B.U2001",
"shortName": "U",
"chi": -146.4615316869476,
"glycosidicBond": "anti"
},
{
"index": 26,
"chain": "B",
"number": 2002,
"icode": null,
"molecule": "RNA",
"fullName": "B.G2002",
"shortName": "G",
"chi": -170.79660912745996,
"glycosidicBond": "anti"
},
{
"index": 27,
"chain": "B",
"number": 2003,
"icode": null,
"molecule": "RNA",
"fullName": "B.G2003",
"shortName": "G",
"chi": -117.68718110874113,
"glycosidicBond": "anti"
},
{
"index": 28,
"chain": "B",
"number": 2004,
"icode": null,
"molecule": "RNA",
"fullName": "B.G2004",
"shortName": "G",
"chi": -153.88587375071324,
"glycosidicBond": "anti"
},
{
"index": 29,
"chain": "B",
"number": 2005,
"icode": null,
"molecule": "RNA",
"fullName": "B.G2005",
"shortName": "G",
"chi": -148.8519912845669,
"glycosidicBond": "anti"
},
{
"index": 30,
"chain": "B",
"number": 2006,
"icode": null,
"molecule": "RNA",
"fullName": "B.U2006",
"shortName": "U",
"chi": -159.43730655241544,
"glycosidicBond": "anti"
},
{
"index": 37,
"chain": "BA",
"number": 2001,
"icode": null,
"molecule": "RNA",
"fullName": "BA.U2001",
"shortName": "U",
"chi": -146.46153168694764,
"glycosidicBond": "anti"
},
{
"index": 38,
"chain": "BA",
"number": 2002,
"icode": null,
"molecule": "RNA",
"fullName": "BA.G2002",
"shortName": "G",
"chi": -170.79660912745993,
"glycosidicBond": "anti"
},
{
"index": 39,
"chain": "BA",
"number": 2003,
"icode": null,
"molecule": "RNA",
"fullName": "BA.G2003",
"shortName": "G",
"chi": -117.68718110874113,
"glycosidicBond": "anti"
},
{
"index": 40,
"chain": "BA",
"number": 2004,
"icode": null,
"molecule": "RNA",
"fullName": "BA.G2004",
"shortName": "G",
"chi": -153.88587375071322,
"glycosidicBond": "anti"
},
{
"index": 41,
"chain": "BA",
"number": 2005,
"icode": null,
"molecule": "RNA",
"fullName": "BA.G2005",
"shortName": "G",
"chi": -148.851991284567,
"glycosidicBond": "anti"
},
{
"index": 42,
"chain": "BA",
"number": 2006,
"icode": null,
"molecule": "RNA",
"fullName": "BA.U2006",
"shortName": "U",
"chi": -159.43730655241544,
"glycosidicBond": "anti"
},
{
"index": 43,
"chain": "BB",
"number": 2001,
"icode": null,
"molecule": "RNA",
"fullName": "BB.U2001",
"shortName": "U",
"chi": -146.4615316869476,
"glycosidicBond": "anti"
},
{
"index": 44,
"chain": "BB",
"number": 2002,
"icode": null,
"molecule": "RNA",
"fullName": "BB.G2002",
"shortName": "G",
"chi": -170.79660912745993,
"glycosidicBond": "anti"
},
{
"index": 45,
"chain": "BB",
"number": 2003,
"icode": null,
"molecule": "RNA",
"fullName": "BB.G2003",
"shortName": "G",
"chi": -117.68718110874106,
"glycosidicBond": "anti"
},
{
"index": 46,
"chain": "BB",
"number": 2004,
"icode": null,
"molecule": "RNA",
"fullName": "BB.G2004",
"shortName": "G",
"chi": -153.8858737507132,
"glycosidicBond": "anti"
},
{
"index": 47,
"chain": "BB",
"number": 2005,
"icode": null,
"molecule": "RNA",
"fullName": "BB.G2005",
"shortName": "G",
"chi": -148.85199128456696,
"glycosidicBond": "anti"
},
{
"index": 48,
"chain": "BB",
"number": 2006,
"icode": null,
"molecule": "RNA",
"fullName": "BB.U2006",
"shortName": "U",
"chi": -159.43730655241544,
"glycosidicBond": "anti"
},
{
"index": 31,
"chain": "BC",
"number": 2001,
"icode": null,
"molecule": "RNA",
"fullName": "BC.U2001",
"shortName": "U",
"chi": -146.4615316869476,
"glycosidicBond": "anti"
},
{
"index": 32,
"chain": "BC",
"number": 2002,
"icode": null,
"molecule": "RNA",
"fullName": "BC.G2002",
"shortName": "G",
"chi": -170.79660912745993,
"glycosidicBond": "anti"
},
{
"index": 33,
"chain": "BC",
"number": 2003,
"icode": null,
"molecule": "RNA",
"fullName": "BC.G2003",
"shortName": "G",
"chi": -117.68718110874121,
"glycosidicBond": "anti"
},
{
"index": 34,
"chain": "BC",
"number": 2004,
"icode": null,
"molecule": "RNA",
"fullName": "BC.G2004",
"shortName": "G",
"chi": -153.88587375071322,
"glycosidicBond": "anti"
},
{
"index": 35,
"chain": "BC",
"number": 2005,
"icode": null,
"molecule": "RNA",
"fullName": "BC.G2005",
"shortName": "G",
"chi": -148.85199128456694,
"glycosidicBond": "anti"
},
{
"index": 36,
"chain": "BC",
"number": 2006,
"icode": null,
"molecule": "RNA",
"fullName": "BC.U2006",
"shortName": "U",
"chi": -159.43730655241544,
"glycosidicBond": "anti"
},
{
"index": 49,
"chain": "C",
"number": 9001,
"icode": null,
"molecule": "Other",
"fullName": "C.SR9001",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 50,
"chain": "CA",
"number": 9001,
"icode": null,
"molecule": "Other",
"fullName": "CA.SR9001",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 51,
"chain": "CB",
"number": 9001,
"icode": null,
"molecule": "Other",
"fullName": "CB.SR9001",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 52,
"chain": "CC",
"number": 9001,
"icode": null,
"molecule": "Other",
"fullName": "CC.SR9001",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 53,
"chain": "D",
"number": 9002,
"icode": null,
"molecule": "Other",
"fullName": "D.SR9002",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 54,
"chain": "DA",
"number": 9002,
"icode": null,
"molecule": "Other",
"fullName": "DA.SR9002",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 55,
"chain": "DB",
"number": 9002,
"icode": null,
"molecule": "Other",
"fullName": "DB.SR9002",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 56,
"chain": "DC",
"number": 9002,
"icode": null,
"molecule": "Other",
"fullName": "DC.SR9002",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 57,
"chain": "E",
"number": 9003,
"icode": null,
"molecule": "Other",
"fullName": "E.NA9003",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 58,
"chain": "EA",
"number": 9003,
"icode": null,
"molecule": "Other",
"fullName": "EA.NA9003",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 59,
"chain": "EB",
"number": 9003,
"icode": null,
"molecule": "Other",
"fullName": "EB.NA9003",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 60,
"chain": "EC",
"number": 9003,
"icode": null,
"molecule": "Other",
"fullName": "EC.NA9003",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 61,
"chain": "F",
"number": 9004,
"icode": null,
"molecule": "Other",
"fullName": "F.SR9004",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 62,
"chain": "FA",
"number": 9004,
"icode": null,
"molecule": "Other",
"fullName": "FA.SR9004",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 63,
"chain": "FB",
"number": 9004,
"icode": null,
"molecule": "Other",
"fullName": "FB.SR9004",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 64,
"chain": "FC",
"number": 9004,
"icode": null,
"molecule": "Other",
"fullName": "FC.SR9004",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 65,
"chain": "G",
"number": 2101,
"icode": null,
"molecule": "Other",
"fullName": "G.SR2101",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 66,
"chain": "GA",
"number": 2101,
"icode": null,
"molecule": "Other",
"fullName": "GA.SR2101",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 67,
"chain": "GB",
"number": 2101,
"icode": null,
"molecule": "Other",
"fullName": "GB.SR2101",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 68,
"chain": "GC",
"number": 2101,
"icode": null,
"molecule": "Other",
"fullName": "GC.SR2101",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 69,
"chain": "H",
"number": 2102,
"icode": null,
"molecule": "Other",
"fullName": "H.SR2102",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 70,
"chain": "HA",
"number": 2102,
"icode": null,
"molecule": "Other",
"fullName": "HA.SR2102",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 71,
"chain": "HB",
"number": 2102,
"icode": null,
"molecule": "Other",
"fullName": "HB.SR2102",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 72,
"chain": "HC",
"number": 2102,
"icode": null,
"molecule": "Other",
"fullName": "HC.SR2102",
"shortName": "R",
"chi": null,
"glycosidicBond": null
},
{
"index": 73,
"chain": "I",
"number": 2103,
"icode": null,
"molecule": "Other",
"fullName": "I.NA2103",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 74,
"chain": "IA",
"number": 2103,
"icode": null,
"molecule": "Other",
"fullName": "IA.NA2103",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 75,
"chain": "IB",
"number": 2103,
"icode": null,
"molecule": "Other",
"fullName": "IB.NA2103",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 76,
"chain": "IC",
"number": 2103,
"icode": null,
"molecule": "Other",
"fullName": "IC.NA2103",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 77,
"chain": "J",
"number": 2104,
"icode": null,
"molecule": "Other",
"fullName": "J.CA2104",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 78,
"chain": "JA",
"number": 2104,
"icode": null,
"molecule": "Other",
"fullName": "JA.CA2104",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 79,
"chain": "JB",
"number": 2104,
"icode": null,
"molecule": "Other",
"fullName": "JB.CA2104",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 80,
"chain": "JC",
"number": 2104,
"icode": null,
"molecule": "Other",
"fullName": "JC.CA2104",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 81,
"chain": "K",
"number": 2105,
"icode": null,
"molecule": "Other",
"fullName": "K.CA2105",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 82,
"chain": "KA",
"number": 2105,
"icode": null,
"molecule": "Other",
"fullName": "KA.CA2105",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 83,
"chain": "KB",
"number": 2105,
"icode": null,
"molecule": "Other",
"fullName": "KB.CA2105",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 84,
"chain": "KC",
"number": 2105,
"icode": null,
"molecule": "Other",
"fullName": "KC.CA2105",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 85,
"chain": "L",
"number": 2106,
"icode": null,
"molecule": "Other",
"fullName": "L.CA2106",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 86,
"chain": "LA",
"number": 2106,
"icode": null,
"molecule": "Other",
"fullName": "LA.CA2106",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 87,
"chain": "LB",
"number": 2106,
"icode": null,
"molecule": "Other",
"fullName": "LB.CA2106",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 88,
"chain": "LC",
"number": 2106,
"icode": null,
"molecule": "Other",
"fullName": "LC.CA2106",
"shortName": "A",
"chi": null,
"glycosidicBond": null
},
{
"index": 89,
"chain": "M",
"number": 9101,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9101",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 90,
"chain": "M",
"number": 9102,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9102",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 91,
"chain": "M",
"number": 9103,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9103",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 92,
"chain": "M",
"number": 9104,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9104",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 93,
"chain": "M",
"number": 9105,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9105",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 94,
"chain": "M",
"number": 9106,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9106",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 95,
"chain": "M",
"number": 9107,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9107",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 96,
"chain": "M",
"number": 9108,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9108",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 97,
"chain": "M",
"number": 9109,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9109",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 98,
"chain": "M",
"number": 9110,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9110",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 99,
"chain": "M",
"number": 9111,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9111",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 100,
"chain": "M",
"number": 9112,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9112",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 101,
"chain": "M",
"number": 9113,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9113",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 102,
"chain": "M",
"number": 9114,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9114",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 103,
"chain": "M",
"number": 9115,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9115",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 104,
"chain": "M",
"number": 9116,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9116",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 105,
"chain": "M",
"number": 9117,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9117",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 106,
"chain": "M",
"number": 9118,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9118",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 107,
"chain": "M",
"number": 9119,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9119",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 108,
"chain": "M",
"number": 9120,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9120",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 109,
"chain": "M",
"number": 9121,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9121",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 110,
"chain": "M",
"number": 9122,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9122",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 111,
"chain": "M",
"number": 9123,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9123",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 112,
"chain": "M",
"number": 9124,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9124",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 113,
"chain": "M",
"number": 9125,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9125",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 114,
"chain": "M",
"number": 9126,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9126",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 115,
"chain": "M",
"number": 9127,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9127",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 116,
"chain": "M",
"number": 9128,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9128",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 117,
"chain": "M",
"number": 9129,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9129",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 118,
"chain": "M",
"number": 9130,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9130",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 119,
"chain": "M",
"number": 9131,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9131",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 120,
"chain": "M",
"number": 9132,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9132",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 121,
"chain": "M",
"number": 9133,
"icode": null,
"molecule": "Other",
"fullName": "M.HOH9133",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 122,
"chain": "MA",
"number": 9101,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9101",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 123,
"chain": "MA",
"number": 9102,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9102",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 124,
"chain": "MA",
"number": 9103,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9103",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 125,
"chain": "MA",
"number": 9104,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9104",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 126,
"chain": "MA",
"number": 9105,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9105",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 127,
"chain": "MA",
"number": 9106,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9106",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 128,
"chain": "MA",
"number": 9107,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9107",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 129,
"chain": "MA",
"number": 9108,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9108",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 130,
"chain": "MA",
"number": 9109,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9109",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 131,
"chain": "MA",
"number": 9110,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9110",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 132,
"chain": "MA",
"number": 9111,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9111",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 133,
"chain": "MA",
"number": 9112,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9112",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 134,
"chain": "MA",
"number": 9113,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9113",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 135,
"chain": "MA",
"number": 9114,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9114",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 136,
"chain": "MA",
"number": 9115,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9115",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 137,
"chain": "MA",
"number": 9116,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9116",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 138,
"chain": "MA",
"number": 9117,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9117",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 139,
"chain": "MA",
"number": 9118,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9118",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 140,
"chain": "MA",
"number": 9119,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9119",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 141,
"chain": "MA",
"number": 9120,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9120",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 142,
"chain": "MA",
"number": 9121,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9121",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 143,
"chain": "MA",
"number": 9122,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9122",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 144,
"chain": "MA",
"number": 9123,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9123",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 145,
"chain": "MA",
"number": 9124,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9124",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 146,
"chain": "MA",
"number": 9125,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9125",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 147,
"chain": "MA",
"number": 9126,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9126",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 148,
"chain": "MA",
"number": 9127,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9127",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 149,
"chain": "MA",
"number": 9128,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9128",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 150,
"chain": "MA",
"number": 9129,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9129",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 151,
"chain": "MA",
"number": 9130,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9130",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 152,
"chain": "MA",
"number": 9131,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9131",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 153,
"chain": "MA",
"number": 9132,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9132",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 154,
"chain": "MA",
"number": 9133,
"icode": null,
"molecule": "Other",
"fullName": "MA.HOH9133",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 155,
"chain": "MB",
"number": 9101,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9101",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 156,
"chain": "MB",
"number": 9102,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9102",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 157,
"chain": "MB",
"number": 9103,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9103",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 158,
"chain": "MB",
"number": 9104,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9104",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 159,
"chain": "MB",
"number": 9105,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9105",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 160,
"chain": "MB",
"number": 9106,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9106",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 161,
"chain": "MB",
"number": 9107,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9107",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 162,
"chain": "MB",
"number": 9108,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9108",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 163,
"chain": "MB",
"number": 9109,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9109",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 164,
"chain": "MB",
"number": 9110,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9110",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 165,
"chain": "MB",
"number": 9111,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9111",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 166,
"chain": "MB",
"number": 9112,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9112",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 167,
"chain": "MB",
"number": 9113,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9113",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 168,
"chain": "MB",
"number": 9114,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9114",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 169,
"chain": "MB",
"number": 9115,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9115",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 170,
"chain": "MB",
"number": 9116,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9116",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 171,
"chain": "MB",
"number": 9117,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9117",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 172,
"chain": "MB",
"number": 9118,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9118",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 173,
"chain": "MB",
"number": 9119,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9119",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 174,
"chain": "MB",
"number": 9120,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9120",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 175,
"chain": "MB",
"number": 9121,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9121",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 176,
"chain": "MB",
"number": 9122,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9122",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 177,
"chain": "MB",
"number": 9123,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9123",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 178,
"chain": "MB",
"number": 9124,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9124",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 179,
"chain": "MB",
"number": 9125,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9125",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 180,
"chain": "MB",
"number": 9126,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9126",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 181,
"chain": "MB",
"number": 9127,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9127",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 182,
"chain": "MB",
"number": 9128,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9128",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 183,
"chain": "MB",
"number": 9129,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9129",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 184,
"chain": "MB",
"number": 9130,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9130",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 185,
"chain": "MB",
"number": 9131,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9131",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 186,
"chain": "MB",
"number": 9132,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9132",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 187,
"chain": "MB",
"number": 9133,
"icode": null,
"molecule": "Other",
"fullName": "MB.HOH9133",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 188,
"chain": "MC",
"number": 9101,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9101",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 189,
"chain": "MC",
"number": 9102,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9102",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 190,
"chain": "MC",
"number": 9103,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9103",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 191,
"chain": "MC",
"number": 9104,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9104",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 192,
"chain": "MC",
"number": 9105,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9105",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 193,
"chain": "MC",
"number": 9106,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9106",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 194,
"chain": "MC",
"number": 9107,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9107",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 195,
"chain": "MC",
"number": 9108,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9108",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 196,
"chain": "MC",
"number": 9109,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9109",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 197,
"chain": "MC",
"number": 9110,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9110",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 198,
"chain": "MC",
"number": 9111,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9111",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 199,
"chain": "MC",
"number": 9112,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9112",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 200,
"chain": "MC",
"number": 9113,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9113",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 201,
"chain": "MC",
"number": 9114,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9114",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 202,
"chain": "MC",
"number": 9115,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9115",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 203,
"chain": "MC",
"number": 9116,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9116",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 204,
"chain": "MC",
"number": 9117,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9117",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 205,
"chain": "MC",
"number": 9118,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9118",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 206,
"chain": "MC",
"number": 9119,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9119",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 207,
"chain": "MC",
"number": 9120,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9120",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 208,
"chain": "MC",
"number": 9121,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9121",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 209,
"chain": "MC",
"number": 9122,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9122",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 210,
"chain": "MC",
"number": 9123,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9123",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 211,
"chain": "MC",
"number": 9124,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9124",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 212,
"chain": "MC",
"number": 9125,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9125",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 213,
"chain": "MC",
"number": 9126,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9126",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 214,
"chain": "MC",
"number": 9127,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9127",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 215,
"chain": "MC",
"number": 9128,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9128",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 216,
"chain": "MC",
"number": 9129,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9129",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 217,
"chain": "MC",
"number": 9130,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9130",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 218,
"chain": "MC",
"number": 9131,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9131",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 219,
"chain": "MC",
"number": 9132,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9132",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 220,
"chain": "MC",
"number": 9133,
"icode": null,
"molecule": "Other",
"fullName": "MC.HOH9133",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 221,
"chain": "N",
"number": 2201,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2201",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 222,
"chain": "N",
"number": 2202,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2202",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 223,
"chain": "N",
"number": 2203,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2203",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 224,
"chain": "N",
"number": 2204,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2204",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 225,
"chain": "N",
"number": 2205,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2205",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 226,
"chain": "N",
"number": 2206,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2206",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 227,
"chain": "N",
"number": 2207,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2207",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 228,
"chain": "N",
"number": 2208,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2208",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 229,
"chain": "N",
"number": 2209,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2209",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 230,
"chain": "N",
"number": 2210,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2210",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 231,
"chain": "N",
"number": 2211,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2211",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 232,
"chain": "N",
"number": 2212,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2212",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 233,
"chain": "N",
"number": 2213,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2213",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 234,
"chain": "N",
"number": 2214,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2214",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 235,
"chain": "N",
"number": 2215,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2215",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 236,
"chain": "N",
"number": 2216,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2216",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 237,
"chain": "N",
"number": 2217,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2217",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 238,
"chain": "N",
"number": 2218,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2218",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 239,
"chain": "N",
"number": 2219,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2219",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 240,
"chain": "N",
"number": 2220,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2220",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 241,
"chain": "N",
"number": 2221,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2221",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 242,
"chain": "N",
"number": 2222,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2222",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 243,
"chain": "N",
"number": 2223,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2223",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 244,
"chain": "N",
"number": 2224,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2224",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 245,
"chain": "N",
"number": 2225,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2225",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 246,
"chain": "N",
"number": 2226,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2226",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 247,
"chain": "N",
"number": 2227,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2227",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 248,
"chain": "N",
"number": 2228,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2228",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 249,
"chain": "N",
"number": 2229,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2229",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 250,
"chain": "N",
"number": 2230,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2230",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 251,
"chain": "N",
"number": 2231,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2231",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 252,
"chain": "N",
"number": 2232,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2232",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 253,
"chain": "N",
"number": 2233,
"icode": null,
"molecule": "Other",
"fullName": "N.HOH2233",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 254,
"chain": "NA",
"number": 2201,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2201",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 255,
"chain": "NA",
"number": 2202,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2202",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 256,
"chain": "NA",
"number": 2203,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2203",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 257,
"chain": "NA",
"number": 2204,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2204",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 258,
"chain": "NA",
"number": 2205,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2205",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 259,
"chain": "NA",
"number": 2206,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2206",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 260,
"chain": "NA",
"number": 2207,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2207",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 261,
"chain": "NA",
"number": 2208,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2208",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 262,
"chain": "NA",
"number": 2209,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2209",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 263,
"chain": "NA",
"number": 2210,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2210",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 264,
"chain": "NA",
"number": 2211,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2211",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 265,
"chain": "NA",
"number": 2212,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2212",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 266,
"chain": "NA",
"number": 2213,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2213",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 267,
"chain": "NA",
"number": 2214,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2214",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 268,
"chain": "NA",
"number": 2215,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2215",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 269,
"chain": "NA",
"number": 2216,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2216",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 270,
"chain": "NA",
"number": 2217,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2217",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 271,
"chain": "NA",
"number": 2218,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2218",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 272,
"chain": "NA",
"number": 2219,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2219",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 273,
"chain": "NA",
"number": 2220,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2220",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 274,
"chain": "NA",
"number": 2221,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2221",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 275,
"chain": "NA",
"number": 2222,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2222",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 276,
"chain": "NA",
"number": 2223,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2223",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 277,
"chain": "NA",
"number": 2224,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2224",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 278,
"chain": "NA",
"number": 2225,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2225",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 279,
"chain": "NA",
"number": 2226,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2226",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 280,
"chain": "NA",
"number": 2227,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2227",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 281,
"chain": "NA",
"number": 2228,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2228",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 282,
"chain": "NA",
"number": 2229,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2229",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 283,
"chain": "NA",
"number": 2230,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2230",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 284,
"chain": "NA",
"number": 2231,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2231",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 285,
"chain": "NA",
"number": 2232,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2232",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 286,
"chain": "NA",
"number": 2233,
"icode": null,
"molecule": "Other",
"fullName": "NA.HOH2233",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 287,
"chain": "NB",
"number": 2201,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2201",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 288,
"chain": "NB",
"number": 2202,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2202",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 289,
"chain": "NB",
"number": 2203,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2203",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 290,
"chain": "NB",
"number": 2204,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2204",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 291,
"chain": "NB",
"number": 2205,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2205",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 292,
"chain": "NB",
"number": 2206,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2206",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 293,
"chain": "NB",
"number": 2207,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2207",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 294,
"chain": "NB",
"number": 2208,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2208",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 295,
"chain": "NB",
"number": 2209,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2209",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 296,
"chain": "NB",
"number": 2210,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2210",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 297,
"chain": "NB",
"number": 2211,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2211",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 298,
"chain": "NB",
"number": 2212,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2212",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 299,
"chain": "NB",
"number": 2213,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2213",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 300,
"chain": "NB",
"number": 2214,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2214",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 301,
"chain": "NB",
"number": 2215,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2215",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 302,
"chain": "NB",
"number": 2216,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2216",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 303,
"chain": "NB",
"number": 2217,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2217",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 304,
"chain": "NB",
"number": 2218,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2218",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 305,
"chain": "NB",
"number": 2219,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2219",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 306,
"chain": "NB",
"number": 2220,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2220",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 307,
"chain": "NB",
"number": 2221,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2221",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 308,
"chain": "NB",
"number": 2222,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2222",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 309,
"chain": "NB",
"number": 2223,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2223",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 310,
"chain": "NB",
"number": 2224,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2224",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 311,
"chain": "NB",
"number": 2225,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2225",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 312,
"chain": "NB",
"number": 2226,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2226",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 313,
"chain": "NB",
"number": 2227,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2227",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 314,
"chain": "NB",
"number": 2228,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2228",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 315,
"chain": "NB",
"number": 2229,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2229",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 316,
"chain": "NB",
"number": 2230,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2230",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 317,
"chain": "NB",
"number": 2231,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2231",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 318,
"chain": "NB",
"number": 2232,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2232",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 319,
"chain": "NB",
"number": 2233,
"icode": null,
"molecule": "Other",
"fullName": "NB.HOH2233",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 320,
"chain": "NC",
"number": 2201,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2201",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 321,
"chain": "NC",
"number": 2202,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2202",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 322,
"chain": "NC",
"number": 2203,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2203",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 323,
"chain": "NC",
"number": 2204,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2204",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 324,
"chain": "NC",
"number": 2205,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2205",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 325,
"chain": "NC",
"number": 2206,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2206",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 326,
"chain": "NC",
"number": 2207,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2207",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 327,
"chain": "NC",
"number": 2208,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2208",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 328,
"chain": "NC",
"number": 2209,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2209",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 329,
"chain": "NC",
"number": 2210,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2210",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 330,
"chain": "NC",
"number": 2211,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2211",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 331,
"chain": "NC",
"number": 2212,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2212",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 332,
"chain": "NC",
"number": 2213,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2213",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 333,
"chain": "NC",
"number": 2214,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2214",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 334,
"chain": "NC",
"number": 2215,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2215",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 335,
"chain": "NC",
"number": 2216,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2216",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 336,
"chain": "NC",
"number": 2217,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2217",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 337,
"chain": "NC",
"number": 2218,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2218",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 338,
"chain": "NC",
"number": 2219,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2219",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 339,
"chain": "NC",
"number": 2220,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2220",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 340,
"chain": "NC",
"number": 2221,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2221",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 341,
"chain": "NC",
"number": 2222,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2222",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 342,
"chain": "NC",
"number": 2223,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2223",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 343,
"chain": "NC",
"number": 2224,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2224",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 344,
"chain": "NC",
"number": 2225,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2225",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 345,
"chain": "NC",
"number": 2226,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2226",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 346,
"chain": "NC",
"number": 2227,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2227",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 347,
"chain": "NC",
"number": 2228,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2228",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 348,
"chain": "NC",
"number": 2229,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2229",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 349,
"chain": "NC",
"number": 2230,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2230",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 350,
"chain": "NC",
"number": 2231,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2231",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 351,
"chain": "NC",
"number": 2232,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2232",
"shortName": "H",
"chi": null,
"glycosidicBond": null
},
{
"index": 352,
"chain": "NC",
"number": 2233,
"icode": null,
"molecule": "Other",
"fullName": "NC.HOH2233",
"shortName": "H",
"chi": null,
"glycosidicBond": null
}
],
"basePairs": [
{
"nt1": "A.G1002",
"nt2": "AB.G1002",
"lw": "cWH"
},
{
"nt1": "A.G1002",
"nt2": "AC.G1002",
"lw": "cHW"
},
{
"nt1": "A.G1003",
"nt2": "AB.G1003",
"lw": "cWH"
},
{
"nt1": "A.G1003",
"nt2": "AC.G1003",
"lw": "cHW"
},
{
"nt1": "A.G1004",
"nt2": "AB.G1004",
"lw": "cWH"
},
{
"nt1": "A.G1004",
"nt2": "AC.G1004",
"lw": "cHW"
},
{
"nt1": "A.G1005",
"nt2": "AB.G1005",
"lw": "cWH"
},
{
"nt1": "A.G1005",
"nt2": "AC.G1005",
"lw": "cHW"
},
{
"nt1": "A.U1006",
"nt2": "AB.U1006",
"lw": "cHW"
},
{
"nt1": "A.U1006",
"nt2": "AC.U1006",
"lw": "cWH"
},
{
"nt1": "AA.G1002",
"nt2": "AC.G1002",
"lw": "cWH"
},
{
"nt1": "AA.G1002",
"nt2": "AB.G1002",
"lw": "cHW"
},
{
"nt1": "AA.G1003",
"nt2": "AC.G1003",
"lw": "cWH"
},
{
"nt1": "AA.G1003",
"nt2": "AB.G1003",
"lw": "cHW"
},
{
"nt1": "AA.G1004",
"nt2": "AC.G1004",
"lw": "cWH"
},
{
"nt1": "AA.G1004",
"nt2": "AB.G1004",
"lw": "cHW"
},
{
"nt1": "AA.G1005",
"nt2": "AC.G1005",
"lw": "cWH"
},
{
"nt1": "AA.G1005",
"nt2": "AB.G1005",
"lw": "cHW"
},
{
"nt1": "AA.U1006",
"nt2": "AC.U1006",
"lw": "cHW"
},
{
"nt1": "AA.U1006",
"nt2": "AB.U1006",
"lw": "cWH"
},
{
"nt1": "AB.G1002",
"nt2": "A.G1002",
"lw": "cHW"
},
{
"nt1": "AB.G1002",
"nt2": "AA.G1002",
"lw": "cWH"
},
{
"nt1": "AB.G1003",
"nt2": "A.G1003",
"lw": "cHW"
},
{
"nt1": "AB.G1003",
"nt2": "AA.G1003",
"lw": "cWH"
},
{
"nt1": "AB.G1004",
"nt2": "A.G1004",
"lw": "cHW"
},
{
"nt1": "AB.G1004",
"nt2": "AA.G1004",
"lw": "cWH"
},
{
"nt1": "AB.G1005",
"nt2": "A.G1005",
"lw": "cHW"
},
{
"nt1": "AB.G1005",
"nt2": "AA.G1005",
"lw": "cWH"
},
{
"nt1": "AB.U1006",
"nt2": "A.U1006",
"lw": "cWH"
},
{
"nt1": "AB.U1006",
"nt2": "AA.U1006",
"lw": "cHW"
},
{
"nt1": "AC.G1002",
"nt2": "AA.G1002",
"lw": "cHW"
},
{
"nt1": "AC.G1002",
"nt2": "A.G1002",
"lw": "cWH"
},
{
"nt1": "AC.G1003",
"nt2": "AA.G1003",
"lw": "cHW"
},
{
"nt1": "AC.G1003",
"nt2": "A.G1003",
"lw": "cWH"
},
{
"nt1": "AC.G1004",
"nt2": "AA.G1004",
"lw": "cHW"
},
{
"nt1": "AC.G1004",
"nt2": "A.G1004",
"lw": "cWH"
},
{
"nt1": "AC.G1005",
"nt2": "AA.G1005",
"lw": "cHW"
},
{
"nt1": "AC.G1005",
"nt2": "A.G1005",
"lw": "cWH"
},
{
"nt1": "AC.U1006",
"nt2": "AA.U1006",
"lw": "cWH"
},
{
"nt1": "AC.U1006",
"nt2": "A.U1006",
"lw": "cHW"
},
{
"nt1": "B.G2002",
"nt2": "BC.G2002",
"lw": "cWH"
},
{
"nt1": "B.G2002",
"nt2": "BB.G2002",
"lw": "cHW"
},
{
"nt1": "B.G2003",
"nt2": "BC.G2003",
"lw": "cWH"
},
{
"nt1": "B.G2003",
"nt2": "BB.G2003",
"lw": "cHW"
},
{
"nt1": "B.G2004",
"nt2": "BC.G2004",
"lw": "cWH"
},
{
"nt1": "B.G2004",
"nt2": "BB.G2004",
"lw": "cHW"
},
{
"nt1": "B.G2005",
"nt2": "BC.G2005",
"lw": "cWH"
},
{
"nt1": "B.G2005",
"nt2": "BB.G2005",
"lw": "cHW"
},
{
"nt1": "B.U2006",
"nt2": "BC.U2006",
"lw": "cHW"
},
{
"nt1": "B.U2006",
"nt2": "BB.U2006",
"lw": "cWH"
},
{
"nt1": "BA.G2002",
"nt2": "BB.G2002",
"lw": "cWH"
},
{
"nt1": "BA.G2002",
"nt2": "BC.G2002",
"lw": "cHW"
},
{
"nt1": "BA.G2003",
"nt2": "BB.G2003",
"lw": "cWH"
},
{
"nt1": "BA.G2003",
"nt2": "BC.G2003",
"lw": "cHW"
},
{
"nt1": "BA.G2004",
"nt2": "BB.G2004",
"lw": "cWH"
},
{
"nt1": "BA.G2004",
"nt2": "BC.G2004",
"lw": "cHW"
},
{
"nt1": "BA.G2005",
"nt2": "BB.G2005",
"lw": "cWH"
},
{
"nt1": "BA.G2005",
"nt2": "BC.G2005",
"lw": "cHW"
},
{
"nt1": "BA.U2006",
"nt2": "BB.U2006",
"lw": "cHW"
},
{
"nt1": "BA.U2006",
"nt2": "BC.U2006",
"lw": "cWH"
},
{
"nt1": "BB.G2002",
"nt2": "BA.G2002",
"lw": "cHW"
},
{
"nt1": "BB.G2002",
"nt2": "B.G2002",
"lw": "cWH"
},
{
"nt1": "BB.G2003",
"nt2": "BA.G2003",
"lw": "cHW"
},
{
"nt1": "BB.G2003",
"nt2": "B.G2003",
"lw": "cWH"
},
{
"nt1": "BB.G2004",
"nt2": "BA.G2004",
"lw": "cHW"
},
{
"nt1": "BB.G2004",
"nt2": "B.G2004",
"lw": "cWH"
},
{
"nt1": "BB.G2005",
"nt2": "BA.G2005",
"lw": "cHW"
},
{
"nt1": "BB.G2005",
"nt2": "B.G2005",
"lw": "cWH"
},
{
"nt1": "BB.U2006",
"nt2": "BA.U2006",
"lw": "cWH"
},
{
"nt1": "BB.U2006",
"nt2": "B.U2006",
"lw": "cHW"
},
{
"nt1": "BC.G2002",
"nt2": "B.G2002",
"lw": "cHW"
},
{
"nt1": "BC.G2002",
"nt2": "BA.G2002",
"lw": "cWH"
},
{
"nt1": "BC.G2003",
"nt2": "B.G2003",
"lw": "cHW"
},
{
"nt1": "BC.G2003",
"nt2": "BA.G2003",
"lw": "cWH"
},
{
"nt1": "BC.G2004",
"nt2": "B.G2004",
"lw": "cHW"
},
{
"nt1": "BC.G2004",
"nt2": "BA.G2004",
"lw": "cWH"
},
{
"nt1": "BC.G2005",
"nt2": "B.G2005",
"lw": "cHW"
},
{
"nt1": "BC.G2005",
"nt2": "BA.G2005",
"lw": "cWH"
},
{
"nt1": "BC.U2006",
"nt2": "B.U2006",
"lw": "cWH"
},
{
"nt1": "BC.U2006",
"nt2": "BA.U2006",
"lw": "cHW"
}
],
"helices": [
{
"quadruplexes": [
{
"tetrads": [
{
"id": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
"nt1": "A.U1006",
"nt2": "AC.U1006",
"nt3": "AA.U1006",
"nt4": "AB.U1006",
"onz": "O-",
"gbaClassification": "VIIIa",
"planarityDeviation": 1.061,
"ionsChannel": [
"NA"
],
"ionsOutside": [
{
"nt": "A.U1006",
"ion": "SR"
},
{
"nt": "AA.U1006",
"ion": "SR"
},
{
"nt": "AB.U1006",
"ion": "SR"
},
{
"nt": "AC.U1006",
"ion": "SR"
}
]
},
{
"id": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
"nt1": "A.G1005",
"nt2": "AC.G1005",
"nt3": "AA.G1005",
"nt4": "AB.G1005",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.7999999999999972,
"ionsChannel": [],
"ionsOutside": []
},
{
"id": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
"nt1": "A.G1004",
"nt2": "AC.G1004",
"nt3": "AA.G1004",
"nt4": "AB.G1004",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.4059999999999988,
"ionsChannel": [
"SR"
],
"ionsOutside": []
},
{
"id": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
"nt1": "A.G1003",
"nt2": "AC.G1003",
"nt3": "AA.G1003",
"nt4": "AB.G1003",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.5549999999999997,
"ionsChannel": [
"SR"
],
"ionsOutside": []
},
{
"id": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
"nt1": "A.G1002",
"nt2": "AC.G1002",
"nt3": "AA.G1002",
"nt4": "AB.G1002",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.541999999999998,
"ionsChannel": [],
"ionsOutside": [
{
"nt": "AB.G1002",
"ion": "CA"
},
{
"nt": "AC.G1002",
"ion": "CA"
},
{
"nt": "AA.G1002",
"ion": "CA"
},
{
"nt": "A.G1002",
"ion": "CA"
}
]
}
],
"onzm": "Op*",
"loopClassification": null,
"gbaClassification": [
"VIII"
],
"tracts": [
[
"A.U1006",
"A.G1005",
"A.G1004",
"A.G1003",
"A.G1002"
],
[
"AC.U1006",
"AC.G1005",
"AC.G1004",
"AC.G1003",
"AC.G1002"
],
[
"AA.U1006",
"AA.G1005",
"AA.G1004",
"AA.G1003",
"AA.G1002"
],
[
"AB.U1006",
"AB.G1005",
"AB.G1004",
"AB.G1003",
"AB.G1002"
]
],
"loops": []
},
{
"tetrads": [
{
"id": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
"nt1": "B.G2002",
"nt2": "BC.G2002",
"nt3": "BA.G2002",
"nt4": "BB.G2002",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.6730000000000018,
"ionsChannel": [],
"ionsOutside": []
},
{
"id": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
"nt1": "B.G2003",
"nt2": "BC.G2003",
"nt3": "BA.G2003",
"nt4": "BB.G2003",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.5769999999999982,
"ionsChannel": [
"SR"
],
"ionsOutside": [
{
"nt": "B.G2003",
"ion": "CA"
},
{
"nt": "BA.G2003",
"ion": "CA"
},
{
"nt": "BB.G2003",
"ion": "CA"
},
{
"nt": "BC.G2003",
"ion": "CA"
}
]
},
{
"id": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
"nt1": "B.G2004",
"nt2": "BC.G2004",
"nt3": "BA.G2004",
"nt4": "BB.G2004",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.2289999999999992,
"ionsChannel": [
"SR"
],
"ionsOutside": []
},
{
"id": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
"nt1": "B.G2005",
"nt2": "BC.G2005",
"nt3": "BA.G2005",
"nt4": "BB.G2005",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.7810000000000006,
"ionsChannel": [
"NA"
],
"ionsOutside": []
},
{
"id": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
"nt1": "B.U2006",
"nt2": "BC.U2006",
"nt3": "BA.U2006",
"nt4": "BB.U2006",
"onz": "O-",
"gbaClassification": "VIIIa",
"planarityDeviation": 1.5840000000000005,
"ionsChannel": [
"NA",
"NA"
],
"ionsOutside": []
}
],
"onzm": "Op*",
"loopClassification": null,
"gbaClassification": [
"VIII"
],
"tracts": [
[
"B.G2002",
"B.G2003",
"B.G2004",
"B.G2005",
"B.U2006"
],
[
"BC.G2002",
"BC.G2003",
"BC.G2004",
"BC.G2005",
"BC.U2006"
],
[
"BA.G2002",
"BA.G2003",
"BA.G2004",
"BA.G2005",
"BA.U2006"
],
[
"BB.G2002",
"BB.G2003",
"BB.G2004",
"BB.G2005",
"BB.U2006"
]
],
"loops": []
}
],
"tetradPairs": [
{
"tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
"tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
"direction": "parallel",
"rise": 3.366499999999995,
"twist": 39.962531742191736
},
{
"tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
"tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
"direction": "parallel",
"rise": 3.308000000000007,
"twist": 25.89614444631925
},
{
"tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
"tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
"direction": "parallel",
"rise": 3.339499999999994,
"twist": 35.81115298630443
},
{
"tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
"tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
"direction": "parallel",
"rise": 3.2865,
"twist": 27.11515971986803
},
{
"tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
"tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
"direction": "parallel",
"rise": 3.369500000000002,
"twist": 28.993180312675573
},
{
"tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
"tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
"direction": "parallel",
"rise": 3.371000000000002,
"twist": 27.410084968596852
},
{
"tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
"tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
"direction": "parallel",
"rise": 3.318000000000005,
"twist": 35.04072146975963
},
{
"tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
"tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
"direction": "parallel",
"rise": 3.2689999999999966,
"twist": 25.149997949938147
},
{
"tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
"tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
"direction": "parallel",
"rise": 7.140499999999998,
"twist": 43.40609492262336
}
]
}
],
"dotBracket": {
"sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU",
"line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a",
"line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a"
}
}
Funding
This research was supported by the National Science Centre, Poland [2016/23/B/ST6/03931, 2019/35/B/ST6/03074] and Mloda Kadra project [09/91/SBAD/0684] from Poznan University of Technology, and carried out in the European Centre for Bioinformatics and Genomics (Poland). The authors also acknowledge partial support by the statutory funds of Poznan University of Technology, Polish Ministry of Science and Higher Education, and the Institute of Bioorganic Chemistry, PAS within intramural financing program.
Bibliography
-
Topology-Based Classification of Tetrads and Quadruplex Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M. Szachniuk. Bioinformatics. 2020. 36(4):1129–1134. doi:10.1093/bioinformatics/btz738
-
ElTetrado: A Tool for Identification and Classification of Tetrads and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. BMC Bioinformatics. 2020. 21(1):40. doi:10.1186/s12859-020-3385-1
-
R-Chie : A Web Server and R Package for Visualizing RNA Secondary Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. Nucleic Acids Research. 2012. 40(12):e95. doi:10.1093/nar/gks241
-
Geometric Nomenclature and Classification of RNA Base Pairs. N.B. Leontis, E. Westhof. RNA. 2001. 7(4):499–512. doi:10.1017/S1355838201002515
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Hashes for eltetrado-1.4.0-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | 33ec8c29bb93f5b3991193e25a1996c49aa6089fc699e9a1f55872d109d5452e |
|
MD5 | 9219deeeb01bff7db245d367bba467d0 |
|
BLAKE2b-256 | 722edeffedc2f235e31ee6b3824e35c20a1373465f3b47dae38d7dc612cba7dd |