Skip to main content

Interval class and fasta access

Project description

An simple interval class for DNA sequences

Typically, you will create a genome and then use that object to create intervals. The intervals have a sequence property that will look up the actual sequence:

>>> from fastinterval import Genome, Interval
>>> test_genome = Genome('test/example.fa')
>>> int1 = test_genome.interval(100, 150, chrom='1')
>>> print int1
1:100-150:
>>> print int1.sequence
GATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA

fastinterval is using pyfasta to retrieve the sequence, so the access is mmapped. It supports strandedness, which will be respected when accessing the sequence:

>>> int2 = test_genome.interval(100, 150, chrom='1', strand=-1)
>>> print int2.sequence
TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC

The Interval class supports many interval operations:

>>> int1 = test_genome.interval(100, 150, chrom='1')
>>> int2 = test_genome.interval(125, 175, chrom='1')
>>> int1.distance(int2)
0
>>> int1.span(int2)
Interval(100, 175)
>>> int1.overlaps(int2)
True
>>> int1.is_contiguous(int2)
True
>>> int1.contains(int2)
False
>>> int1.intersection(int2)
Interval(125, 150)
>>> int1.union(int2)
Interval(100, 175)
>>> Interval.merge([int1, int2, test_genome.interval(200,250, chrom='1')])
[Interval(100, 175), Interval(200, 250)]

The Interval class is also based on bx python intervals. So you can pass in a value attritbue to point to an external object, and create interval trees and so on.

>>> from bx.intervals.intersection import IntervalTree
>>> int3 = test_genome.interval(150, 200, chrom='1', value='foo')
>>> tree = IntervalTree()
>>> _ = map(tree.insert_interval, (int1, int2, int3))
>>> tree.find(190, 195)
[Interval(150, 200, value=foo)]

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Filename, size & hash SHA256 hash help File type Python version Upload date
fastinterval-0.0.1.tar.gz (4.8 kB) Copy SHA256 hash SHA256 Source None

Supported by

Elastic Elastic Search Pingdom Pingdom Monitoring Google Google BigQuery Sentry Sentry Error logging AWS AWS Cloud computing DataDog DataDog Monitoring Fastly Fastly CDN SignalFx SignalFx Supporter DigiCert DigiCert EV certificate StatusPage StatusPage Status page