fastinterval 0.0.1

Interval class and fasta access

An simple interval class for DNA sequences

Typically, you will create a genome and then use that object to create intervals. The intervals have a sequence property that will look up the actual sequence:

>>> from fastinterval import Genome, Interval
>>> test_genome = Genome('test/example.fa')
>>> int1 = test_genome.interval(100, 150, chrom='1')
>>> print int1
1:100-150:
>>> print int1.sequence
GATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA

fastinterval is using pyfasta to retrieve the sequence, so the access is mmapped. It supports strandedness, which will be respected when accessing the sequence:

>>> int2 = test_genome.interval(100, 150, chrom='1', strand=-1)
>>> print int2.sequence
TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC

The Interval class supports many interval operations:

>>> int1 = test_genome.interval(100, 150, chrom='1')
>>> int2 = test_genome.interval(125, 175, chrom='1')
>>> int1.distance(int2)
0
>>> int1.span(int2)
Interval(100, 175)
>>> int1.overlaps(int2)
True
>>> int1.is_contiguous(int2)
True
>>> int1.contains(int2)
False
>>> int1.intersection(int2)
Interval(125, 150)
>>> int1.union(int2)
Interval(100, 175)
>>> Interval.merge([int1, int2, test_genome.interval(200,250, chrom='1')])
[Interval(100, 175), Interval(200, 250)]

The Interval class is also based on bx python intervals. So you can pass in a value attritbue to point to an external object, and create interval trees and so on.

>>> from bx.intervals.intersection import IntervalTree
>>> int3 = test_genome.interval(150, 200, chrom='1', value='foo')
>>> tree = IntervalTree()
>>> _ = map(tree.insert_interval, (int1, int2, int3))
>>> tree.find(190, 195)
[Interval(150, 200, value=foo)]