Skip to main content
This is a pre-production deployment of Warehouse. Changes made here affect the production instance of PyPI (pypi.python.org).
Help us improve Python packaging - Donate today!

Interval class and fasta access

Project Description

An simple interval class for DNA sequences

Typically, you will create a genome and then use that object to create intervals. The intervals have a sequence property that will look up the actual sequence:

>>> from fastinterval import Genome, Interval
>>> test_genome = Genome('test/example.fa')
>>> int1 = test_genome.interval(100, 150, chrom='1')
>>> print int1
1:100-150:
>>> print int1.sequence
GATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA

fastinterval is using pyfasta to retrieve the sequence, so the access is mmapped. It supports strandedness, which will be respected when accessing the sequence:

>>> int2 = test_genome.interval(100, 150, chrom='1', strand=-1)
>>> print int2.sequence
TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC

The Interval class supports many interval operations:

>>> int1 = test_genome.interval(100, 150, chrom='1')
>>> int2 = test_genome.interval(125, 175, chrom='1')
>>> int1.distance(int2)
0
>>> int1.span(int2)
Interval(100, 175)
>>> int1.overlaps(int2)
True
>>> int1.is_contiguous(int2)
True
>>> int1.contains(int2)
False
>>> int1.intersection(int2)
Interval(125, 150)
>>> int1.union(int2)
Interval(100, 175)
>>> Interval.merge([int1, int2, test_genome.interval(200,250, chrom='1')])
[Interval(100, 175), Interval(200, 250)]

The Interval class is also based on bx python intervals. So you can pass in a value attritbue to point to an external object, and create interval trees and so on.

>>> from bx.intervals.intersection import IntervalTree
>>> int3 = test_genome.interval(150, 200, chrom='1', value='foo')
>>> tree = IntervalTree()
>>> _ = map(tree.insert_interval, (int1, int2, int3))
>>> tree.find(190, 195)
[Interval(150, 200, value=foo)]
Release History

Release History

History Node

0.1.1

History Node

0.1.0

This version
History Node

0.0.1

Download Files

Download Files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
fastinterval-0.0.1.tar.gz (4.8 kB) Copy SHA256 Checksum SHA256 Source Feb 15, 2012

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting