filter_illumina_index
Filter a Illumina FASTQ file based on index sequence.
Reads a Illumina FASTQ file and compares the sequence index in the
sample number position of the sequence identifier to a supplied sequence
index. Entries that match the sequence index are filtered into the filtered
file (if any) and entries that don't match are filtered into the unfiltered
file (if any). Displays the count of total, filtered and unfiltered reads,
as well as the number of mismatches found across all reads. Matching tolerating
a certain number of mismatches (-m parameter), and compression for input
and output are supported (detected on the basis of file extension).
Specifying an empty index, (-i "" or -i with no argument) enables
'passthrough' mode where all reads are directed to the output filtered file with
no processing. Passthrough mode is useful if this program is part of a workflow
that needs to be adapted to files that do not have a valid Illumina index, as it
allows all processing of this program to be skipped.
Illumina index
For information on Illumina sequence identifiers in FASTQ files, see FASTQ Files from Illumina. This includes the following excerpt:
For the Undetermined FASTQ files only, the sequence observed in the index read
is written to the FASTQ header in place of the sample number. This information
can be useful for troubleshooting demultiplexing.
@<instrument>:<run number>:<flowcell ID>:<lane>:<tile>:<x-pos>:<y-pos> <read>:<is filtered>:<control number>:<sample number>
This script assumes the <sample number> value is the Illumina index. To
ensure rapid processing, the value following the final colon(:) is used
without confirming the sequence identifier conforms to the above format, or
whether the index is actually a nucleotide sequence.
Usage details
usage: filter_illumina_index [-h] [--version] [-f FILTERED] [-u UNFILTERED] -i
[INDEX] [-m MISMATCHES] [-t THREADS]
[-l {1,2,3,4,5,6,7,8,9}] [-v]
inputfile
positional arguments:
inputfile Input FASTQ file, compression (`.gz`, `.bz2` and
`.xz`) supported
optional arguments:
-h, --help show this help message and exit
--version show program's version number and exit
-f FILTERED, --filtered FILTERED
Output FASTQ file containing filtered (positive)
reads; compression detected by extension (default:
None)
-u UNFILTERED, --unfiltered UNFILTERED
Output FASTQ file containing unfiltered (negative)
reads; compression detected by extension (default:
None)
-m MISMATCHES, --mismatches MISMATCHES
Maximum number of mismatches to tolerate (default: 0)
-t THREADS, --threads THREADS
Number of threads to pass to `xopen` for each open
file; use 0 to turn off `pigz` use and rely on
`gzip.open` so no extra threads spawned. (default: 1)
-l {1,2,3,4,5,6,7,8,9}, --compresslevel {1,2,3,4,5,6,7,8,9}
Compression level for writing gzip files; ignored if
gzip compression not used (default: 6)
-v, --verbose Increase logging verbosity, available levels 1 to 2
with `-v` to `-vv` (default: 0)
required named arguments:
-i [INDEX], --index [INDEX]
Sequence index to filter for; if empty (i.e. no
argument or "") then program will run in "passthrough"
mode with all reads directed to filtered file with no
processing (default: None)
Example usage
The directory filter_illumina_index/tests/data/ (within the location where
the package is installed) contains various test files, for example
test_reads_GATCGTGT.fastq with 29 reads containing barcode GATCGTGT and
one read with a 1-nt mismatch of AATCGTGT. Running this program with the
following command:
filter_illumina_index filter_illumina_index/tests/data/test_reads_GATCGTGT.fastq --index GATCGTGT --filtered /tmp/filtered_reads.fastq --unfiltered /tmp/unfiltered_reads.fastq
will process that input file with no mismatches allowed (default) for the index
GATCGTGT. The output files are /tmp/filtered_reads.fastq with 29 reads
containing the GATCGTGT barcode, and /tmp/unfiltered_reads.fastq with 1 read
containing the mismatched-barcode AATCGTGT. The following log to stdout will
be displayed:
filter_illumina_index 1.0.5
Input file: filter_illumina_index/tests/data/test_reads_GATCGTGT.fastq
Filtering for sequence index: GATCGTGT
Max mismatches tolerated: 0
Output filtered file: /tmp/filtered_reads.fastq
Output unfiltered file: /tmp/unfiltered_reads.fastq
Total reads: 30
Filtered reads: 29
Unfiltered reads: 1
Reads with 0 mismatches: 29
Reads with 1 mismatches: 1
Reads with 2 mismatches: 0
Reads with 3 mismatches: 0
Reads with 4 mismatches: 0
Reads with 5 mismatches: 0
Reads with 6 mismatches: 0
Reads with 7 mismatches: 0
Reads with 8 mismatches: 0
Reads with >=9 mismatches: 0
Example usage with two indexes
Version 1.0.5 adds support for two indexes separated by a user-specified separator. Reads are filtered by the total number of mismatches in both indexes. Alternatively, either index can be left blank in which case all reads for that index will be passed through, and only the non-blank index will be used for filtering.
The test file test_reads_GATCGTGT+TCTATCCT.fastq contains two indexes
GATCGTGT and TCTATCCT separated by a + character, with 24 reads containing
no mismatches, and one read each with the following number of mismatches for the
two barcodes: (1,0), (0,1), (1,1), (2,1), (1,2), (2,2).
Running this program with the following command:
filter_illumina_index filter_illumina_index/tests/data/test_reads_GATCGTGT+TCTATCCT.fastq --index GATCGTGT --separator + --index2 TCTATCCT --filtered /tmp/filtered_reads.fastq --unfiltered /tmp/unfiltered_reads.fastq
will process that input file with no mismatches allowed (default) for the
both indexes. The output files are /tmp/filtered_reads.fastq with 24 reads
containing both the GATCGTGT and TCTATCCT barcodes, and
/tmp/unfiltered_reads.fastq with 6 reads containing any mismatches.
The following log to stdout will be displayed:
filter_illumina_index 1.0.5
Input file: filter_illumina_index/tests/data/test_reads_GATCGTGT+TCTATCCT.fastq
Filtering for sequence index 1: GATCGTGT
Filtering for sequence index 2: TCTATCCT
Separator between index 1 and 2: +
Max mismatches tolerated: 0
Output filtered file: /tmp/filtered_reads.fastq
Output unfiltered file: /tmp/unfiltered_reads.fastq
Total reads: 30
Filtered reads: 24
Unfiltered reads: 6
Reads with 0 mismatches: 24
Reads with 1 mismatches: 2
Reads with 2 mismatches: 1
Reads with 3 mismatches: 2
Reads with 4 mismatches: 1
Reads with 5 mismatches: 0
Reads with 6 mismatches: 0
Reads with 7 mismatches: 0
Reads with 8 mismatches: 0
Reads with >=9 mismatches: 0
Alternatively, the following command could be used to filter by the second barcode only:
filter_illumina_index filter_illumina_index/tests/data/test_reads_GATCGTGT+TCTATCCT.fastq --index --separator + --index2 TCTATCCT --filtered /tmp/filtered_reads.fastq --unfiltered /tmp/unfiltered_reads.fastq
Or (with "" used for --index):
filter_illumina_index filter_illumina_index/tests/data/test_reads_GATCGTGT+TCTATCCT.fastq --index "" --separator + --index2 TCTATCCT --filtered /tmp/filtered_reads.fastq --unfiltered /tmp/unfiltered_reads.fastq
This will process that input file with no mismatches allowed (default) for the
second TCTATCCT index. The first indexes (before the +) is ignored.
The output files are /tmp/filtered_reads.fastq with 25 reads
containing the TCTATCCT barcodes with no mismatches, and
/tmp/unfiltered_reads.fastq with 5 reads containing any mismatches in this
barcode. The following log to stdout will be displayed:
filter_illumina_index 1.0.5
Input file: filter_illumina_index/tests/data/test_reads_GATCGTGT+TCTATCCT.fastq
Filtering for sequence index 1: (passthrough)
Filtering for sequence index 2: TCTATCCT
Separator between index 1 and 2: +
Max mismatches tolerated: 0
Output filtered file: /tmp/filtered_reads.fastq
Output unfiltered file: /tmp/unfiltered_reads.fastq
Total reads: 30
Filtered reads: 25
Unfiltered reads: 5
Reads with 0 mismatches: 25
Reads with 1 mismatches: 3
Reads with 2 mismatches: 2
Reads with 3 mismatches: 0
Reads with 4 mismatches: 0
Reads with 5 mismatches: 0
Reads with 6 mismatches: 0
Reads with 7 mismatches: 0
Reads with 8 mismatches: 0
Reads with >=9 mismatches: 0
A similar approach can be used to filter by the first barcode only using one of the following commands:
filter_illumina_index filter_illumina_index/tests/data/test_reads_GATCGTGT+TCTATCCT.fastq --index GATCGTGT --separator + --index2 --filtered /tmp/filtered_reads.fastq --unfiltered /tmp/unfiltered_reads.fastq
Or:
filter_illumina_index filter_illumina_index/tests/data/test_reads_GATCGTGT+TCTATCCT.fastq --index GATCGTGT --separator + --index2 "" --filtered /tmp/filtered_reads.fastq --unfiltered /tmp/unfiltered_reads.fastq
Note that both --separator and --index2 must be provided, although with
the latter left blank.
The program does not support filtering by a certain number of mismatches for each barcode, only by the total. This functionality, however, could be obtained using two passes and processing each barcode separately with passthrough for the other barcode.
Algorithm details
The barcode is read from the sequence number position of the sequence identifier
using a very simplistic method to optimise performance: the field in the
sequence identifier following the last colon (:) character is used, e.g.
@FAKE-SEQ:1:FAKE-FLOWCELL-ID:1:1:0:1 1:N:0:TGACCAAT
^ : last colon
^^^^^^^^ : taken
TGACCAAT : barcode
If there is no colon in the sequence identifier, an exception is produced as no barcode can be found, except in passthrough mode (which does no actual processing and redirects all reads to the filtered file). The number of mismatches is simply the number of characters that differ between the provided index sequence and the barcode from the read. Any missing characters in either the provided index or the barcode are counted as mismatches. The comparison is performed at the start of the each set of characters with no provision for wildcards, insertions or deletions, e.g.
TGACCAAT index
TGACCAAT read barcode
0 mismatches
TGACCAAT index
AGACCAAT read barcode
^ 1 mismatch
TGACCAAT index
GACCAAT read barcode
^^^ ^ ^^ 6 mismatches
TGACCAAT index
TGACCAAAA read barcode
^^ 2 mismatches
TGACCAAT index
NNNCCAAT read barcode
^^^ 3 mismatches
NNNCCAAT index
TGACCAAT read barcode
^^^ 3 mismatches
NNNCCAAT index
NNNCCAAT read barcode
0 mismatches
TGACCAAT index
TGACCAATTGACCAATTGACCAAT read barcode
^^^^^^^^^^^^^^^^ 16 mismatches
Where there is a greater number of characters in the read barcode than the
provided index, the number of mismatches is summarised as >=index length+1,
i.e. the final entry above will be counted as >=9 mismatches.
When two barcodes are present, the sequence identifier field is split into two substrings at the first instance of the character(s) provided as the separator. Then each barcode is processed with the rules above with the total number of mismatches used to filter reads. If either barcode is left blank, then only the non-blank barcode is used.
File reading/writing and threading
This script uses the dnaio and xopen packages for reading/writing FASTQ
files with compression support. The xopen package used for reading/writing
compressed files spawns pigz processes to speed-up processing. The --threads
parameter indicates the number of threads passed to the xopen() function. With
--threads 1 there is still a small amount of multithreading as a different
pigz process is spawned for each open file and up to 3 files are open at once
(one input and two output), although this is largely throttled by the sequential
nature of the script processing. To prevent these pigz processes being
spawned, --threads 0 can be used, which causes a fallback to gzip.open at
an additional performance cost (it is slower than pigz).
In order for pigz to be used, it must be installed on the system, otherwise
a gzip process is used. The pigz package is available on conda in the
conda-forge channel, so can easily be installed in the same conda environment
as this program.
xopen supports automatic compression according to the file extension, with
.gz, .bz2 and .xz supported. Only the first of these has been tested
with this script but the others are expected to work without issue.
Additional details
- Author: Tet Woo Lee
- Copyright: © 2018-2020 Tet Woo Lee
- Licence: GPLv3
- Dependencies:
dnaio, tested with v0.4.1
xopen, tested with v0.9.0
Change log
version 1.0.5 2023-12-14 Update to allow two indexes separated by user-specified separator, and allowing passthrough for each index. Bugfix counting mismatches if >= max tracked.
version 1.0.4r2 2020-04-11
Minor changes to README.md only, version not incremented in program.
version 1.0.4 2020-04-11
Speed up and algorithm changes
- Switch to
dnaioover Biopython to improve speed (>3x faster + multi- threading support for compression) - Change mismatch calculation algorithm, now includes any characters missing in filter-by index or read index
- Exception if no barcode detected outside of passthrough mode
- Add unit tests
version 1.0.3.post2 2020-04-01
Improved output
- Add version number to output
- Show parameters in output
- Allow no argument for passthrough mode
version 1.0.3.post1 2020-04-01
Minor bugfix
- Bugfix: Bump version number in script
version 1.0.3 2020-04-01
Added passthrough mode with empty index
version 1.0.2 2018-12-19
Shows statistics on number of mismatches found
version 1.0.1 2018-12-19
Speed up number of mismatches calculation
version 1.0 2018-12-14
Minor updates for PyPi and conda packaging
version 1.0.dev1 2018-12-13
First working version
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file filter_illumina_index-1.0.5.tar.gz.
File metadata
- Download URL: filter_illumina_index-1.0.5.tar.gz
- Upload date:
- Size: 39.1 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/4.0.1 CPython/3.10.5
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
782475ffec4a0841f165894e491ab90c0cb7dbbeb18358265143d99ab5b3d53a
|
|
| MD5 |
30d64b51a446011676db2acb6de74d16
|
|
| BLAKE2b-256 |
75842aec7f86b11b5e8abfeaa3d318a32c952a4f1d4902335073bcf734000056
|
File details
Details for the file filter_illumina_index-1.0.5-py3-none-any.whl.
File metadata
- Download URL: filter_illumina_index-1.0.5-py3-none-any.whl
- Upload date:
- Size: 85.1 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/4.0.1 CPython/3.10.5
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
8fe0548d69e7db5b3d63ec6ef5803e3a584b7fb17356566eb3a153064ee5013a
|
|
| MD5 |
026308ca9517452e7b4944e238f481b9
|
|
| BLAKE2b-256 |
af76bc5d2a5da99cf097232bdf27eb1e44abfd28fab770cdf79bcae541d06ea7
|