Skip to main content

Filter a Illumina FASTQ file based on index sequence

Project description

filter_illumina_index

Filter a Illumina FASTQ file based on index sequence.

Reads a Illumina FASTQ file and compares the sequence index in the sample number position of the sequence identifier to a supplied sequence index. Entries that match the sequence index are filtered into the filtered file (if any) and entries that don't match are filtered into the unfiltered file (if any). Displays the count of total, filtered and unfiltered reads, as well as the number of mismatches found across all reads. Matching tolerating a certain number of mismatches (-m parameter), and gzip compression for input (detected on the basis of file extension) and output (specified using -c parameter) are supported.

Specifying an empty index, (-i "" or -i with no argumenent) enables 'passthrough' mode where all reads are directed to the output filtered file with no processing. Passthrough mode is useful if this program is part of a workflow that needs to be adapted to files that do not have a valid Illumina index, as it allows all processing of this program to be skipped.

For information on Illumina sequence identifiers in FASTQ files, see: http://support.illumina.com/content/dam/illumina-support/help/BaseSpaceHelp_v2/Content/Vault/Informatics/Sequencing_Analysis/BS/swSEQ_mBS_FASTQFiles.htm

Usage details

usage: filter_illumina_index [-h] [--version] [-f FILTERED] [-u UNFILTERED] -i
                             [INDEX] [-m MISMATCHES] [-c] [-v]
                             inputfile

positional arguments:
  inputfile             Input FASTQ file, compression supported

optional arguments:
  -h, --help            show this help message and exit
  --version             show program's version number and exit
  -f FILTERED, --filtered FILTERED
                        Output FASTQ file containing filtered (positive) reads
                        (default: None)
  -u UNFILTERED, --unfiltered UNFILTERED
                        Output FASTQ file containing unfiltered (negative)
                        reads (default: None)
  -m MISMATCHES, --mismatches MISMATCHES
                        Maximum number of mismatches to tolerate (default: 0)
  -c, --compressed      Compress output files (note: file extension not
                        modified) (default: False)
  -v, --verbose         Show verbose output (default: False)

required named arguments:
  -i [INDEX], --index [INDEX]
                        Sequence index to filter for; if empty (i.e. no
                        argument or "") then program will run in "passthrough"
                        mode with all reads directed to filtered file with no
                        processing (default: None)

Example usage

The directory `` contains example reads in FASTQ and compressed FASTQ format with index GATCGTGT and one read with a mismatch.

To test, run:

filter_illumina_index usr/example_reads.fastq --index GATCGTGT --filtered var/filtered_reads.fastq --unfiltered var/unfiltered_reads.fastq

python filter_illumina_index/filter_illumina_index.py usr/example_reads.fastq --index GATCGTGT filter_illumina_index 1.0.4.dev1 Input file: usr/example_reads.fastq Filtering for sequence index: GATCGTGT Max mismatches tolerated: 0 Output filtered file: None Output unfiltered file: None Total reads: 30 Filtered reads: 29 Unfiltered reads: 1 Reads with 0 mismatches: 29 Reads with 1 mismatches: 1 Reads with 2 mismatches: 0 Reads with 3 mismatches: 0 Reads with 4 mismatches: 0 Reads with 5 mismatches: 0 Reads with 6 mismatches: 0 Reads with 7 mismatches: 0 Reads with 8 mismatches: 0 Reads with >=9 mismatches: 0

This will process srv/example_reads.fastq, matching to index GATCGTGT with no mismatches allowed (default). Reads matching this index will be saved to var/filtered_reads.fastq and those not matching this index will be saved to var/unfiltered_reads.fastq. In addition, the following output will be displayed:

filter_illumina_index 1.0.4.dev1
Input file: usr/example_reads.fastq
Filtering for sequence index: GATCGTGT
Max mismatches tolerated: 0
Output filtered file: None
Output unfiltered file: None
Total reads: 30
Filtered reads: 29
Unfiltered reads: 1
 Reads with 0 mismatches: 29
 Reads with 1 mismatches: 1
 Reads with 2 mismatches: 0
 Reads with 3 mismatches: 0
 Reads with 4 mismatches: 0
 Reads with 5 mismatches: 0
 Reads with 6 mismatches: 0
 Reads with 7 mismatches: 0
 Reads with 8 mismatches: 0
 Reads with >=9 mismatches: 0

Algorithm details

The barcode is read from the sequence number position of the sequence identifier using a very simplistic method to optimise performance: the field in the sequence identifier following the last colon (:) character is used, e.g.

@FAKE-SEQ:1:FAKE-FLOWCELL-ID:1:1:0:1 1:N:0:TGACCAAT
                                          ^         : last colon
                                           ^^^^^^^^ : taken
                                           TGACCAAT : barcode

The number of mismatches is simply the number of characters that differ between the provided index sequence and the barcode from the read. Any missing characters in either the provided index or the barcode are counted as mismatches. The comparison is performed at the start of the each set of characters with no provision for wildcards, insertions or deletions, e.g.

TGACCAAT index
TGACCAAT read barcode
         0 mismatches

TGACCAAT index
AGACCAAT read barcode
^        1 mismatch

TGACCAAT index
GACCAAT  read barcode
^^^ ^ ^^ 6 mismatches

TGACCAAT index
TGACCAAAA read barcode
       ^^ 2 mismatches

TGACCAAT index
NNNCCAAT read barcode
^^^      3 mismatches

NNNCCAAT index
TGACCAAT read barcode
^^^      3 mismatches

NNNCCAAT index
NNNCCAAT read barcode
         0 mismatches

TGACCAAT index
TGACCAATTGACCAATTGACCAAT read barcode
        ^^^^^^^^^^^^^^^^ 16 mismatches

Where there is a greater number of characters in the read barcode than the provided index, the number of mismatches is summarised as >=index length+1, i.e. the final entry above will be counted as >=9 mismatches.

File reading/writing and threading

This script uses the dnaio and xopen packages for reading/writing FASTQ files with compression support. The xopen package used for reading/writing compressed files spawns pigz processes to speed-up processing. The --threads parameter indicates the number of threads passed to the xopen() function. With --threads 1 there is still a small amount of multithreading as a different pigz process is spawned for each open file and up to 3 files are open at once (one input and two output), although this is largely throttled by the sequential nature of the script processing. To prevent these pigz processes being spawned, --threads 0 can be used, which causes a fallback to gzip.open at an additional performance cost (it is slower than pigz).

xopen supports automatic compression according to the file extension, with .gz, .bz2 and .xz supported. Only the first of these has been tested with this script but the others are expected to work without issue.


Additional details

  • Author: Tet Woo Lee
  • Copyright: © 2018-2020 Tet Woo Lee
  • Licence: GPLv3
  • Dependencies:
    dnaio, tested with v0.4.1
    xopen, tested with v0.8.4

Change log

version 1.0.3.post2 2020-01-04
Improved output

  • Add version number to output
  • Show parameters in output
  • Allow no argument for passthrough mode

version 1.0.3.post1 2020-01-04
Minor bugfix

  • Bugfix: Bump version number in script

version 1.0.3 2020-01-04
Added passthrough mode with empty index

version 1.0.2 2018-12-19
Shows statistics on number of mismatches found

version 1.0.1 2018-12-19
Speed up number of mismatches calculation

version 1.0 2018-12-14
Minor updates for PyPi and conda packaging

version 1.0.dev1 2018-12-13
First working version

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

filter_illumina_index-1.0.4.dev1.tar.gz (35.5 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

filter_illumina_index-1.0.4.dev1-py3-none-any.whl (59.3 kB view details)

Uploaded Python 3

File details

Details for the file filter_illumina_index-1.0.4.dev1.tar.gz.

File metadata

  • Download URL: filter_illumina_index-1.0.4.dev1.tar.gz
  • Upload date:
  • Size: 35.5 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.1.1 pkginfo/1.5.0.1 requests/2.23.0 setuptools/46.1.3.post20200325 requests-toolbelt/0.9.1 tqdm/4.43.0 CPython/3.8.2

File hashes

Hashes for filter_illumina_index-1.0.4.dev1.tar.gz
Algorithm Hash digest
SHA256 78ad75cbd8b4408b2ae5d24013b7b5e06e7a5b4b17aefeb4b164636aa7f4ffc5
MD5 4725217ae5350f015137c780d56e97be
BLAKE2b-256 31370b3bb3f393fd36bf3437aca63ef02ba211198812f4d7754e4f2bebf4ca57

See more details on using hashes here.

File details

Details for the file filter_illumina_index-1.0.4.dev1-py3-none-any.whl.

File metadata

  • Download URL: filter_illumina_index-1.0.4.dev1-py3-none-any.whl
  • Upload date:
  • Size: 59.3 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.1.1 pkginfo/1.5.0.1 requests/2.23.0 setuptools/46.1.3.post20200325 requests-toolbelt/0.9.1 tqdm/4.43.0 CPython/3.8.2

File hashes

Hashes for filter_illumina_index-1.0.4.dev1-py3-none-any.whl
Algorithm Hash digest
SHA256 e840fbbe11e03df0f142d2dfcdfdeaa878256d19b03263a184b3ab013364fea6
MD5 4776f4978fcd0c506611705978827bf2
BLAKE2b-256 c248b00d3b977ac21bd2e9a86a1ee991c22c0d4075989a439c82b5baa5e25535

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page