Skip to main content

A Python package for designing influenza reverse genetics primers using the seamless cloning methods (e.g. Gibson assembly, CPEC assembly).

Project description

# FluGibson

![Travis Status](https://travis-ci.org/ericmjl/flu-gibson.svg)

A tool for designing primers to clone influenza polymerase segments from viral cDNA.

# Installation

The installation requires the following packages:

  1. networkx

  2. biopython

  3. pandas (optional)

  4. matplotlib (optional)

From Github:

  1. Download this repository as a Zip file.

  2. Unzip the file.

  3. In your terminal, navigate to the FluGibson directory.

  4. Run command: python setup.py install

From PyPI:

  1. (if applicable) Switch to your proper Python environment.

  2. Run command: pip install FluGibson

Using Conda:

  1. (if applicable) Switch to your proper Python environment.

  2. Run command: conda install FluGibson

# Usage

## Scripted

One way to use FluGibson is to use the provided script in the /examples directory. Copy the script to your working directory.

Create the FASTA formatted files containing the DNA parts that you want to stitch together. For example, you would use the following FASTA definition to stitch the following 3 parts together:

>PART_1 >CATCTATCTCTCTACTGCGAGGCTATTCGACTGGCCGTTACTCGCCGGTACGTAGCTCGGTCTCGATCATCAGTACGTCTACGTGTCGTCGTACTTACACGGTCGCTCGGACTGACGTACGTCTACGTCGTCTGACTGA

>PART_2 >CTACTGTCTGCTGATGGTACGTACGTGAGTACGCGCAGCACAGACACTACTTACTCTCGCGCGAGAGCTATCTACGACTACGTACTCGTCGTACGAGCTGACTGATCGACGTAGCTTGACGTACGTATCACGTACGTATCG

>PART_3 >CAGCTTCGGCGCGATTACTCTACGAGCACGACGCAGCTGTCGCTGTCTGGTCTACGCTAGCGCTACGACTATCGATCAGCGTCGTACTGACGTGACGCGCATCGACGTTCGGACGTCGTCGTCGTACGACGTCTACGATGC

The parts will be joined in the order PART_1–>PART_2–>PART_3.

To produce the CSV file that has all of the primers listed, from the command line, run python compute_primers.py. You will get a CSV file, named all_primers.csv, that will house the primers that you will need to order.

# Changelog

## Version 1.2

Added a class that converts one nucleotide sequence into another, using Gibson assembly primers.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

FluGibson-1.2.tar.gz (11.0 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

FluGibson-1.2-py3-none-any.whl (24.8 kB view details)

Uploaded Python 3

File details

Details for the file FluGibson-1.2.tar.gz.

File metadata

  • Download URL: FluGibson-1.2.tar.gz
  • Upload date:
  • Size: 11.0 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No

File hashes

Hashes for FluGibson-1.2.tar.gz
Algorithm Hash digest
SHA256 122074da9ebdf2ee94a18e754cb96d809869347d7d2e5bf4aceaa4c6a73e3de5
MD5 8cfb26a3338f00b5e8a2313c806b8874
BLAKE2b-256 2cef50595729a22e179918dde0fa41f5743c8f5628b041d5581eca754d2bfca4

See more details on using hashes here.

File details

Details for the file FluGibson-1.2-py3-none-any.whl.

File metadata

File hashes

Hashes for FluGibson-1.2-py3-none-any.whl
Algorithm Hash digest
SHA256 f79e7e73e0710023eaebaa9a08dcb3c72d60a23577aafbd2e77334fe180b03fa
MD5 f467864790c7fdd015b04d8a584f5b30
BLAKE2b-256 1aeca94fff9c8ec5923a96cbfab5113dff37237c85ddd445094138c7f053aa1d

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page