Skip to main content
Latest Version Test Coverage Wheels Supported Python versions Supported Python implementations License

Fuzzy search: Find parts of long text or data, allowing for some changes/typos.

Highly optimized, simple to use, does one thing well.

>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]
  • Two simple functions to use: one for in-memory data and one for files

    • Fastest search algorithm is chosen automatically

  • Levenshtein Distance metric with configurable parameters

    • Separately configure the max. allowed distance, substitutions, deletions and/or insertions

  • Advanced algorithms with optional C and Cython optimizations

  • Properly handles Unicode; special optimizations for binary data

  • Simple installation:
    • pip install fuzzysearch just works

    • pure-Python fallbacks for compiled modules

    • only one dependency (attrs)

  • Extensively tested

  • Free software: MIT license

For more info, see the documentation.

How is this different than FuzzyWuzzy or RapidFuzz?

The main difference is that fuzzysearch searches for fuzzy matches through long texts or data. FuzzyWuzzy and RapidFuzz, on the other hand, are intended for fuzzy comparison of pairs of strings, identifying how closely they match according to some metric such as the Levenshtein distance.

These are very different use-cases, and the solutions are very different as well.

How is this different than ElasticSearch and Lucene?

The main difference is that fuzzysearch does no indexing or other preparations; it directly searches through the given text or data for a given sub-string. Therefore, it is much simpler to use compared to systems based on text indexing.

Installation

fuzzysearch supports Python versions 3.8+, as well as PyPy 3.9 and 3.10.

$ pip install fuzzysearch

This will work even if installing the C and Cython extensions fails, using pure-Python fallbacks.

Usage

Just call find_near_matches() with the sub-sequence you’re looking for, the sequence to search, and the matching parameters:

>>> from fuzzysearch import find_near_matches
# search for 'PATTERN' with a maximum Levenshtein Distance of 1
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]

To search in a file, use find_near_matches_in_file():

>>> from fuzzysearch import find_near_matches_in_file
>>> with open('data_file', 'rb') as f:
...     find_near_matches_in_file(b'PATTERN', f, max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]

Examples

fuzzysearch is great for ad-hoc searches of genetic data, such as DNA or protein sequences, before reaching for more complex tools:

>>> sequence = '''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG'''
>>> subsequence = 'TGCACTGTAGGGATAACAAT' # distance = 1
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1, matched="TAGCACTGTAGGGATAACAAT")]

BioPython sequences are also supported:

>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> sequence = Seq('''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG''', IUPAC.unambiguous_dna)
>>> subsequence = Seq('TGCACTGTAGGGATAACAAT', IUPAC.unambiguous_dna)
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1, matched="TAGCACTGTAGGGATAACAAT")]

Matching Criteria

The search function supports four possible match criteria, which may be supplied in any combination:

  • maximum Levenshtein distance (max_l_dist)

  • maximum # of subsitutions

  • maximum # of deletions (“delete” = skip a character in the sub-sequence)

  • maximum # of insertions (“insert” = skip a character in the sequence)

Not supplying a criterion means that there is no limit for it. For this reason, one must always supply max_l_dist and/or all other criteria.

>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]

# this will not match since max-deletions is set to zero
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1, max_deletions=0)
[]

# note that a deletion + insertion may be combined to match a substution
>>> find_near_matches('PATTERN', '---PAT-ERN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=1, matched="PAT-ERN")] # the Levenshtein distance is still 1

# ... but deletion + insertion may also match other, non-substitution differences
>>> find_near_matches('PATTERN', '---PATERRN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=2, matched="PATERRN")]

History

0.8.1 (2025-11-11)

  • Fixed sometimes raising ValueError with empty sequences.

  • Added support for Python 3.13 and 3.14.

0.8.0 (2025-05-24)

  • Fixed a long-standing occasional crash, mostly happening on Windows.

  • Overhauled CI.

  • Dropped support for Python 2.7, 3.5, 3.6 and 3.7.

  • Added support for Python 3.9, 3.10, 3.11 and 3.12.

0.7.3 (2020-06-27)

  • Fixed segmentation faults due to wrong handling of inputs in bytes-like-only functions in C extensions.

0.7.2 (2020-05-07)

  • Added PyPy support.

  • Several minor bug fixes.

0.7.1 (2020-04-05)

  • Dropped support for Python 3.4.

  • Removed deprecation warning with Python 3.8.

  • Fixed a couple of nasty bugs.

0.7.0 (2020-01-14)

  • Added matched attribue to Match objects containing the matched part of the sequence.

  • Added support for CPython 3.8. Now supporting CPython 2.7 and 3.4-3.8.

0.6.2 (2019-04-22)

  • Fix calling search_exact() without passing end_index.

  • Fix edge case: max. dist >= sub-sequence length.

0.6.1 (2018-12-08)

  • Fixed some C compiler warnings for the C and Cython modules

0.6.0 (2018-12-07)

  • Dropped support for Python versions 2.6, 3.2 and 3.3

  • Added support and testing for Python 3.7

  • Optimized the n-grams Levenshtein search for long sub-sequences

  • Further optimized the n-grams Levenshtein search

  • Cython versions of the optimized parts of the n-grams Levenshtein search

0.5.0 (2017-09-05)

  • Fixed search_exact_byteslike() to support supplying start and end indexes

  • Added support for lists, tuples and other Sequence types to search_exact()

  • Fixed a bug where find_near_matches() could return a wrong Match.end with max_l_dist=0

  • Added more tests and improved some existing ones.

0.4.0 (2017-07-06)

  • Added support and testing for Python 3.5 and 3.6

  • Many small improvements to README, setup.py and CI testing

0.3.0 (2015-02-12)

  • Added C extensions for several search functions as well as internal functions

  • Use C extensions if available, or pure-Python implementations otherwise

  • setup.py attempts to build C extensions, but installs without if build fails

  • Added --noexts setup.py option to avoid trying to build the C extensions

  • Greatly improved testing and coverage

0.2.2 (2014-03-27)

  • Added support for searching through BioPython Seq objects

  • Added specialized search function allowing only subsitutions and insertions

  • Fixed several bugs

0.2.1 (2014-03-14)

  • Fixed major match grouping bug

0.2.0 (2013-03-13)

  • New utility function find_near_matches() for easier use

  • Additional documentation

0.1.0 (2013-11-12)

  • Two working implementations

  • Extensive test suite; all tests passing

  • Full support for Python 2.6-2.7 and 3.1-3.3

  • Bumped status from Pre-Alpha to Alpha

0.0.1 (2013-11-01)

  • First release on PyPI.

Metadata

Release files for fuzzysearch 0.8.1

For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.

Source distribution (sdist)

Source distribution for fuzzysearch 0.8.1
File Size Uploaded
fuzzysearch-0.8.1.tar.gz 39.5 kB Details

Built distributions (wheels)

Table of built distributions (wheels) for fuzzysearch 0.8.1
File
fuzzysearch-0.8.1-cp312-cp312-win_amd64.whl CPython 3.12 CPython 3.12 Windows x86-64 Details
fuzzysearch-0.8.1-cp312-cp312-win32.whl CPython 3.12 CPython 3.12 Windows x86-32 Details
fuzzysearch-0.8.1-cp312-cp312-musllinux_1_2_x86_64.whl CPython 3.12 CPython 3.12 Linux musl 1.2+ x86-64 Details
fuzzysearch-0.8.1-cp312-cp312-musllinux_1_2_i686.whl CPython 3.12 CPython 3.12 Linux musl 1.2+ x86-32 Details
fuzzysearch-0.8.1-cp312-cp312-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl CPython 3.12 CPython 3.12 Linux glibc 2.5+ x86-64, Linux glibc 2.17+ x86-64 Details
fuzzysearch-0.8.1-cp312-cp312-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl CPython 3.12 CPython 3.12 Linux glibc 2.17+ x86-32, Linux glibc 2.5+ x86-32 Details
fuzzysearch-0.8.1-cp312-cp312-macosx_11_0_arm64.whl CPython 3.12 CPython 3.12 macOS 11.0+ ARM64 Details
fuzzysearch-0.8.1-cp312-cp312-macosx_10_9_x86_64.whl CPython 3.12 CPython 3.12 macOS 10.9+ x86-64 Details
fuzzysearch-0.8.1-cp311-cp311-win_amd64.whl CPython 3.11 CPython 3.11 Windows x86-64 Details
fuzzysearch-0.8.1-cp311-cp311-win32.whl CPython 3.11 CPython 3.11 Windows x86-32 Details
fuzzysearch-0.8.1-cp311-cp311-musllinux_1_2_x86_64.whl CPython 3.11 CPython 3.11 Linux musl 1.2+ x86-64 Details
fuzzysearch-0.8.1-cp311-cp311-musllinux_1_2_i686.whl CPython 3.11 CPython 3.11 Linux musl 1.2+ x86-32 Details
fuzzysearch-0.8.1-cp311-cp311-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl CPython 3.11 CPython 3.11 Linux glibc 2.17+ x86-64, Linux glibc 2.5+ x86-64 Details
fuzzysearch-0.8.1-cp311-cp311-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl CPython 3.11 CPython 3.11 Linux glibc 2.17+ x86-32, Linux glibc 2.5+ x86-32 Details
fuzzysearch-0.8.1-cp311-cp311-macosx_11_0_arm64.whl CPython 3.11 CPython 3.11 macOS 11.0+ ARM64 Details
fuzzysearch-0.8.1-cp311-cp311-macosx_10_9_x86_64.whl CPython 3.11 CPython 3.11 macOS 10.9+ x86-64 Details
fuzzysearch-0.8.1-cp310-cp310-win_amd64.whl CPython 3.10 CPython 3.10 Windows x86-64 Details
fuzzysearch-0.8.1-cp310-cp310-win32.whl CPython 3.10 CPython 3.10 Windows x86-32 Details
fuzzysearch-0.8.1-cp310-cp310-musllinux_1_2_x86_64.whl CPython 3.10 CPython 3.10 Linux musl 1.2+ x86-64 Details
fuzzysearch-0.8.1-cp310-cp310-musllinux_1_2_i686.whl CPython 3.10 CPython 3.10 Linux musl 1.2+ x86-32 Details
fuzzysearch-0.8.1-cp310-cp310-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl CPython 3.10 CPython 3.10 Linux glibc 2.17+ x86-64, Linux glibc 2.5+ x86-64 Details
fuzzysearch-0.8.1-cp310-cp310-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl CPython 3.10 CPython 3.10 Linux glibc 2.5+ x86-32, Linux glibc 2.17+ x86-32 Details
fuzzysearch-0.8.1-cp310-cp310-macosx_11_0_arm64.whl CPython 3.10 CPython 3.10 macOS 11.0+ ARM64 Details
fuzzysearch-0.8.1-cp310-cp310-macosx_10_9_x86_64.whl CPython 3.10 CPython 3.10 macOS 10.9+ x86-64 Details
fuzzysearch-0.8.1-cp39-cp39-win_amd64.whl CPython 3.9 CPython 3.9 Windows x86-64 Details
fuzzysearch-0.8.1-cp39-cp39-win32.whl CPython 3.9 CPython 3.9 Windows x86-32 Details
fuzzysearch-0.8.1-cp39-cp39-musllinux_1_2_x86_64.whl CPython 3.9 CPython 3.9 Linux musl 1.2+ x86-64 Details
fuzzysearch-0.8.1-cp39-cp39-musllinux_1_2_i686.whl CPython 3.9 CPython 3.9 Linux musl 1.2+ x86-32 Details
fuzzysearch-0.8.1-cp39-cp39-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl CPython 3.9 CPython 3.9 Linux glibc 2.5+ x86-64, Linux glibc 2.17+ x86-64 Details
fuzzysearch-0.8.1-cp39-cp39-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl CPython 3.9 CPython 3.9 Linux glibc 2.17+ x86-32, Linux glibc 2.5+ x86-32 Details
fuzzysearch-0.8.1-cp39-cp39-macosx_11_0_arm64.whl CPython 3.9 CPython 3.9 macOS 11.0+ ARM64 Details
fuzzysearch-0.8.1-cp39-cp39-macosx_10_9_x86_64.whl CPython 3.9 CPython 3.9 macOS 10.9+ x86-64 Details
fuzzysearch-0.8.1-cp38-cp38-win_amd64.whl CPython 3.8 CPython 3.8 Windows x86-64 Details
fuzzysearch-0.8.1-cp38-cp38-win32.whl CPython 3.8 CPython 3.8 Windows x86-32 Details
fuzzysearch-0.8.1-cp38-cp38-musllinux_1_2_x86_64.whl CPython 3.8 CPython 3.8 Linux musl 1.2+ x86-64 Details
fuzzysearch-0.8.1-cp38-cp38-musllinux_1_2_i686.whl CPython 3.8 CPython 3.8 Linux musl 1.2+ x86-32 Details
fuzzysearch-0.8.1-cp38-cp38-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl CPython 3.8 CPython 3.8 Linux glibc 2.5+ x86-64, Linux glibc 2.17+ x86-64 Details
fuzzysearch-0.8.1-cp38-cp38-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl CPython 3.8 CPython 3.8 Linux glibc 2.17+ x86-32, Linux glibc 2.5+ x86-32 Details
fuzzysearch-0.8.1-cp38-cp38-macosx_11_0_arm64.whl CPython 3.8 CPython 3.8 macOS 11.0+ ARM64 Details
fuzzysearch-0.8.1-cp38-cp38-macosx_10_9_x86_64.whl CPython 3.8 CPython 3.8 macOS 10.9+ x86-64 Details

Total release size: 1.8 MB

Release files / fuzzysearch-0.8.1.tar.gz

Download URL fuzzysearch-0.8.1.tar.gz
Size 39.5 kB
Tags Source
SHA-256 checksum
How to use checksums
e5f50962c6b1c3dfc6c8cdfd5e2604838c95cb10118e4cab518e5292e9e0b1c6
BLAKE2b-256 checksum
How to use checksums
e9b4d92b429ba4bfe5461faa358f84092eceb5ea8985cd2e448daf38bba17737
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp312-cp312-win_amd64.whl

Download URL fuzzysearch-0.8.1-cp312-cp312-win_amd64.whl
Size 36.8 kB
Tags CPython 3.12 Windows x86-64
SHA-256 checksum
How to use checksums
46bb36a6c5a966d951125136379a8674377ceea9f755fd542536065a6d47d23e
BLAKE2b-256 checksum
How to use checksums
5810f2cef42d66311554723cfc1f7295ba1a83b3dd763845219bba3120bb3c08
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp312-cp312-win32.whl

Download URL fuzzysearch-0.8.1-cp312-cp312-win32.whl
Size 35.1 kB
Tags CPython 3.12 Windows x86-32
SHA-256 checksum
How to use checksums
040693ed5c6c3b15807a240b7acf535cacd12771ca5094cec1df62c960010642
BLAKE2b-256 checksum
How to use checksums
9b3f29d666a60f711a77354a5b23082fe210b4d0277e5d6e9e5146cf56162315
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp312-cp312-musllinux_1_2_x86_64.whl

Download URL fuzzysearch-0.8.1-cp312-cp312-musllinux_1_2_x86_64.whl
Size 56.7 kB
Tags CPython 3.12 Linux musl 1.2+ x86-64
SHA-256 checksum
How to use checksums
f4f11634b0d22dbd36513dae77b2f794d63b0275879da050b379f91bab398225
BLAKE2b-256 checksum
How to use checksums
aca6c73e8ebc7e6e4ee7f8d2c509c232781dfc79451ebda2254915e0cef17566
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp312-cp312-musllinux_1_2_i686.whl

Download URL fuzzysearch-0.8.1-cp312-cp312-musllinux_1_2_i686.whl
Size 56.3 kB
Tags CPython 3.12 Linux musl 1.2+ x86-32
SHA-256 checksum
How to use checksums
ea17a28427fb750bbec47f2169f223f81a8388e81535f90d0590efd94489f803
BLAKE2b-256 checksum
How to use checksums
0f7d23f8d9d137187f5dfececd14f16f79e8257eb0fd2e85397306474f987710
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp312-cp312-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl

Download URL fuzzysearch-0.8.1-cp312-cp312-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
Size 57.2 kB
Tags CPython 3.12 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64
SHA-256 checksum
How to use checksums
85e5a4f8099517b2bfa384668160fd06b020106e86c6077d21e93a6b4fb348eb
BLAKE2b-256 checksum
How to use checksums
7d3671a9bd65e361083ed3cbab135cd3a82ae2b089cbca6608af6106acc9017c
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp312-cp312-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl

Download URL fuzzysearch-0.8.1-cp312-cp312-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl
Size 55.4 kB
Tags CPython 3.12 Linux glibc 2.17+ x86-32 Linux glibc 2.5+ x86-32
SHA-256 checksum
How to use checksums
5d19cf0ebfefe54737a0477defc218123a0addb9d52f43711286aab94603e288
BLAKE2b-256 checksum
How to use checksums
363cd193b6b80d88d7e3b2c3a45fd582dedcb3b47c3bf2ffb2b85083e3b3ba8a
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp312-cp312-macosx_11_0_arm64.whl

Download URL fuzzysearch-0.8.1-cp312-cp312-macosx_11_0_arm64.whl
Size 32.5 kB
Tags CPython 3.12 macOS 11.0+ ARM64
SHA-256 checksum
How to use checksums
a8187ebcfea9f76387b57a618480ff536ff2a5da67d5dd31af4c252bf8842d45
BLAKE2b-256 checksum
How to use checksums
2bcef75349a22df809ea7a4433ff9e24edfbc3cfa160600f159b50e0e4e272a4
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp312-cp312-macosx_10_9_x86_64.whl

Download URL fuzzysearch-0.8.1-cp312-cp312-macosx_10_9_x86_64.whl
Size 31.8 kB
Tags CPython 3.12 macOS 10.9+ x86-64
SHA-256 checksum
How to use checksums
d3caa5c635ac87c67f58b8a50792073014989e0689263c494e81f5d2ced24101
BLAKE2b-256 checksum
How to use checksums
ef5f0b0b2a56d59472becda3b7788e532e25d6a74451679d7d99b411a24553e7
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp311-cp311-win_amd64.whl

Download URL fuzzysearch-0.8.1-cp311-cp311-win_amd64.whl
Size 36.8 kB
Tags CPython 3.11 Windows x86-64
SHA-256 checksum
How to use checksums
b3aaa93889e309efa06754570fda8e98b5a7fd63cef8b67701deac7ef201acbf
BLAKE2b-256 checksum
How to use checksums
4639b5534c7b81b24d207343684f1403b16aa8f59d22e2931310a398bce650a3
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp311-cp311-win32.whl

Download URL fuzzysearch-0.8.1-cp311-cp311-win32.whl
Size 35.2 kB
Tags CPython 3.11 Windows x86-32
SHA-256 checksum
How to use checksums
80967eafa2cf44168fcd798a4bf62e6d8fd195cfb57ae62dff037cce2262b497
BLAKE2b-256 checksum
How to use checksums
484a064436a220277190fc2887ef5f050009d941adda9fb7232b9780e0c8d73e
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp311-cp311-musllinux_1_2_x86_64.whl

Download URL fuzzysearch-0.8.1-cp311-cp311-musllinux_1_2_x86_64.whl
Size 55.7 kB
Tags CPython 3.11 Linux musl 1.2+ x86-64
SHA-256 checksum
How to use checksums
75d4669836d986135942268209e2b7686ed31dca552a7cf56c98e3802dbc5d9c
BLAKE2b-256 checksum
How to use checksums
e19f55433fcbcfa681a0253b7bca17b1147ff771512b2f00f986c34b5beb014e
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp311-cp311-musllinux_1_2_i686.whl

Download URL fuzzysearch-0.8.1-cp311-cp311-musllinux_1_2_i686.whl
Size 55.5 kB
Tags CPython 3.11 Linux musl 1.2+ x86-32
SHA-256 checksum
How to use checksums
5eda34e841745c99873e02b2b425d806dbfc075d823f813d8cd68ff12e375095
BLAKE2b-256 checksum
How to use checksums
4a59645c1c3101875d9f07d7e28b6dc5ee2bb1d4c40ae42dbea22cb858f50042
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp311-cp311-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl

Download URL fuzzysearch-0.8.1-cp311-cp311-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
Size 56.3 kB
Tags CPython 3.11 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64
SHA-256 checksum
How to use checksums
066c3dafa48b3967f7d4a343c0a7ea081af9edafb99f2915a80d33a9b0a4bfc9
BLAKE2b-256 checksum
How to use checksums
889650a2c640e5c3a161a09235a262234792d01317fab466af64ad05180389db
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp311-cp311-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl

Download URL fuzzysearch-0.8.1-cp311-cp311-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl
Size 54.6 kB
Tags CPython 3.11 Linux glibc 2.17+ x86-32 Linux glibc 2.5+ x86-32
SHA-256 checksum
How to use checksums
e4bc99cacb03c0f64ad64e0caaeb31298819cc7db63491fc9b876dd7f88ef81d
BLAKE2b-256 checksum
How to use checksums
b7717e4bd895b69538a6fe6744308eebf2742e2ad50aec50b433374c4a30b491
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp311-cp311-macosx_11_0_arm64.whl

Download URL fuzzysearch-0.8.1-cp311-cp311-macosx_11_0_arm64.whl
Size 32.5 kB
Tags CPython 3.11 macOS 11.0+ ARM64
SHA-256 checksum
How to use checksums
c0e9bbcf199907beac9b3d616bf3fec1695095bf4c813ef6c90307791fe18664
BLAKE2b-256 checksum
How to use checksums
0ae46aba3595fa67ab9bd0ff98fea2c6453b4a9587372b80d28fdbc51927b41b
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp311-cp311-macosx_10_9_x86_64.whl

Download URL fuzzysearch-0.8.1-cp311-cp311-macosx_10_9_x86_64.whl
Size 31.8 kB
Tags CPython 3.11 macOS 10.9+ x86-64
SHA-256 checksum
How to use checksums
def3fc3379d3390cba7e2a34c55888b619484172f59b985f10e9784d79d6f14b
BLAKE2b-256 checksum
How to use checksums
f8205fdd4fb37746a0b87104731e7237e7efb98e12cb0d91181ea9249a6ad14b
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp310-cp310-win_amd64.whl

Download URL fuzzysearch-0.8.1-cp310-cp310-win_amd64.whl
Size 36.8 kB
Tags CPython 3.10 Windows x86-64
SHA-256 checksum
How to use checksums
797d4f6470e8287cdd0ca8de9993fdc932ce51ea75cd4ea963ce1e71dc20bc2a
BLAKE2b-256 checksum
How to use checksums
dbee4af7df35303ef8a3f095de2c6bea0ec2eeaf149e4b324c9f1408b778a7cb
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp310-cp310-win32.whl

Download URL fuzzysearch-0.8.1-cp310-cp310-win32.whl
Size 35.2 kB
Tags CPython 3.10 Windows x86-32
SHA-256 checksum
How to use checksums
7fac1c6db91dbaf9c5874ec9e87db884aa48bfdc264e8868af315d61140ba629
BLAKE2b-256 checksum
How to use checksums
ca08c2c6d04585f44ed8f6145bba383cace482237ae3d1acae9cc577d01f387a
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp310-cp310-musllinux_1_2_x86_64.whl

Download URL fuzzysearch-0.8.1-cp310-cp310-musllinux_1_2_x86_64.whl
Size 55.6 kB
Tags CPython 3.10 Linux musl 1.2+ x86-64
SHA-256 checksum
How to use checksums
e04ec175642e945b16ce01d2d61d1640385577b470301cf8d8c9545c01eb9ae0
BLAKE2b-256 checksum
How to use checksums
6e8070e5f0940555b62885c9a39e6fbc339875cd71d4149f66f28cfaf982d1fe
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp310-cp310-musllinux_1_2_i686.whl

Download URL fuzzysearch-0.8.1-cp310-cp310-musllinux_1_2_i686.whl
Size 55.4 kB
Tags CPython 3.10 Linux musl 1.2+ x86-32
SHA-256 checksum
How to use checksums
928cef6c24b21120abb37e5bdd8a89dd2f71fb07af1e867c6ced282de81c0cc8
BLAKE2b-256 checksum
How to use checksums
980b778a54487be30a7e1e5b3788cac7d2ee4e7134460a1db258fb72691958b0
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp310-cp310-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl

Download URL fuzzysearch-0.8.1-cp310-cp310-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
Size 56.3 kB
Tags CPython 3.10 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64
SHA-256 checksum
How to use checksums
a2acd7c3940f063e35bf34619100fa58ff88985264777f908458503a89b9bb33
BLAKE2b-256 checksum
How to use checksums
e89cf85a643489dc9f3bd549940e6c47e44393f35684730f935fd23583244f84
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp310-cp310-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl

Download URL fuzzysearch-0.8.1-cp310-cp310-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl
Size 54.5 kB
Tags CPython 3.10 Linux glibc 2.17+ x86-32 Linux glibc 2.5+ x86-32
SHA-256 checksum
How to use checksums
d6bd4f9e18b5decb8603d96b477e49dd3b81743bdc77dc5389f51eb4f8abc621
BLAKE2b-256 checksum
How to use checksums
7555b2c854fcdfde9a893985181495d05659739fc0d17f4515c0f3a7f4763058
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp310-cp310-macosx_11_0_arm64.whl

Download URL fuzzysearch-0.8.1-cp310-cp310-macosx_11_0_arm64.whl
Size 32.5 kB
Tags CPython 3.10 macOS 11.0+ ARM64
SHA-256 checksum
How to use checksums
757f8d680411df73828bd3981613a8322ba18f9cf7e4a53792ad52c0f5203e09
BLAKE2b-256 checksum
How to use checksums
ce6da771c014836bed5e074abf7bdd670370359453b7f935b664f86f899bb935
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp310-cp310-macosx_10_9_x86_64.whl

Download URL fuzzysearch-0.8.1-cp310-cp310-macosx_10_9_x86_64.whl
Size 31.8 kB
Tags CPython 3.10 macOS 10.9+ x86-64
SHA-256 checksum
How to use checksums
9d25c1e260f38dfda74cbbfd51211e4e644867d023131a5b8061050212d9a0d6
BLAKE2b-256 checksum
How to use checksums
666007436c45651c310dac13f0eb383da5e3b34d717ffecf769b019ff5ab6b4c
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp39-cp39-win_amd64.whl

Download URL fuzzysearch-0.8.1-cp39-cp39-win_amd64.whl
Size 36.8 kB
Tags CPython 3.9 Windows x86-64
SHA-256 checksum
How to use checksums
47b333de960fa83e08dddee3415c521fa6c14eefe12c8880da55f1e52394252a
BLAKE2b-256 checksum
How to use checksums
f3247c5b4334671dee88ac2689286dd8961fbb4cb5b73c419c8f816862390fc7
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp39-cp39-win32.whl

Download URL fuzzysearch-0.8.1-cp39-cp39-win32.whl
Size 35.2 kB
Tags CPython 3.9 Windows x86-32
SHA-256 checksum
How to use checksums
0d2b61b41154132278f094aeac1a7f2f8d2956b97c773110e43892424bf1b2c2
BLAKE2b-256 checksum
How to use checksums
873e13ee6a67eca103525404752ed4b78824dd1191cea8bd0d1aacf7ffaffea8
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp39-cp39-musllinux_1_2_x86_64.whl

Download URL fuzzysearch-0.8.1-cp39-cp39-musllinux_1_2_x86_64.whl
Size 55.2 kB
Tags CPython 3.9 Linux musl 1.2+ x86-64
SHA-256 checksum
How to use checksums
54cb7e7de6a49a473580bd149c0b1ff638adfad62efa0e1c8e5ed5f1d76a435b
BLAKE2b-256 checksum
How to use checksums
e7ad8c2e722bd54d71424a3743af62d17cfb8a7e32088b8f3147e85a584c3c67
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp39-cp39-musllinux_1_2_i686.whl

Download URL fuzzysearch-0.8.1-cp39-cp39-musllinux_1_2_i686.whl
Size 55.0 kB
Tags CPython 3.9 Linux musl 1.2+ x86-32
SHA-256 checksum
How to use checksums
03b2c0904d3e099383de2898a4d86e5c6496d0b6713554ea68814b27748df972
BLAKE2b-256 checksum
How to use checksums
00ea1208945412bc72d9d588d74768b41bdde53a7a62e85fe210538436ff35fb
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp39-cp39-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl

Download URL fuzzysearch-0.8.1-cp39-cp39-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
Size 55.9 kB
Tags CPython 3.9 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64
SHA-256 checksum
How to use checksums
4ede17a32e234df9a12462a97e6ce87ba4b1501ec22dfda55fe00e89c254e9fa
BLAKE2b-256 checksum
How to use checksums
ac8492b32f9eb74f640fac25f6f572431920b1304626025303fa3d9dbf1e0026
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp39-cp39-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl

Download URL fuzzysearch-0.8.1-cp39-cp39-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl
Size 54.1 kB
Tags CPython 3.9 Linux glibc 2.17+ x86-32 Linux glibc 2.5+ x86-32
SHA-256 checksum
How to use checksums
b888c12da3eba248f594ac492227c5849afb03002f33097c68327ca1de79f98a
BLAKE2b-256 checksum
How to use checksums
a0bd05818bbc46e81dfbffdad62fa880a08c4e5f2ff4e24ee652d4312ccd4cf9
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp39-cp39-macosx_11_0_arm64.whl

Download URL fuzzysearch-0.8.1-cp39-cp39-macosx_11_0_arm64.whl
Size 32.5 kB
Tags CPython 3.9 macOS 11.0+ ARM64
SHA-256 checksum
How to use checksums
732ec7670bf1ba2d3776a2cd34d4f746cb76a66025766c84f9c18f11a7f34529
BLAKE2b-256 checksum
How to use checksums
4816fa852dcce0d54c2d8e8b776adc7928f4511492cc762b6cc46d786b43e524
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp39-cp39-macosx_10_9_x86_64.whl

Download URL fuzzysearch-0.8.1-cp39-cp39-macosx_10_9_x86_64.whl
Size 31.8 kB
Tags CPython 3.9 macOS 10.9+ x86-64
SHA-256 checksum
How to use checksums
874b8987f846eb740768a552044bb04051861e14d02de246efa09a8c6d45e006
BLAKE2b-256 checksum
How to use checksums
d32441bc34504b722c3b8124a603e96566ccccb5862f12f1f78e3e1eaee5ec1b
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp38-cp38-win_amd64.whl

Download URL fuzzysearch-0.8.1-cp38-cp38-win_amd64.whl
Size 36.7 kB
Tags CPython 3.8 Windows x86-64
SHA-256 checksum
How to use checksums
3980ae9e1eb11262b1576afcb513c491f39f1f5ea3cb16cb480bfb85245a5b96
BLAKE2b-256 checksum
How to use checksums
f2e8569b7a83cbe780d097332b43980f6c18ce8d13e259ddf9181a23376ea3e9
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp38-cp38-win32.whl

Download URL fuzzysearch-0.8.1-cp38-cp38-win32.whl
Size 35.1 kB
Tags CPython 3.8 Windows x86-32
SHA-256 checksum
How to use checksums
4217ea58d23724a7eb07d73a7c3a57661005b99bf77cbf67bc66abc3af2d55cb
BLAKE2b-256 checksum
How to use checksums
d2fe3906fd0c6937d7b7395579ea0f5809dcf0075cdccfda37b768a767c5a087
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp38-cp38-musllinux_1_2_x86_64.whl

Download URL fuzzysearch-0.8.1-cp38-cp38-musllinux_1_2_x86_64.whl
Size 55.9 kB
Tags CPython 3.8 Linux musl 1.2+ x86-64
SHA-256 checksum
How to use checksums
914e2f3026bb8c64076e82f871456b9902726fcd77df1504bd6a30b1796e60f3
BLAKE2b-256 checksum
How to use checksums
206be14166a3b30122d48704bb9d19b16da6716cc511e0dd890858197424676b
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp38-cp38-musllinux_1_2_i686.whl

Download URL fuzzysearch-0.8.1-cp38-cp38-musllinux_1_2_i686.whl
Size 55.6 kB
Tags CPython 3.8 Linux musl 1.2+ x86-32
SHA-256 checksum
How to use checksums
6991e16ecf91cd1ca0b4156e86fc2c416d185cf26c705cc97f650d6aa22ba66f
BLAKE2b-256 checksum
How to use checksums
8a351a4b66e567fb8c44bb9b2025633fdf26e41f901298ad72a10195efcdde0d
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp38-cp38-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl

Download URL fuzzysearch-0.8.1-cp38-cp38-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
Size 57.6 kB
Tags CPython 3.8 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64
SHA-256 checksum
How to use checksums
e66940d634aac6125bd65c2791ebbb297c8ed98bc05a9af76f2899b97d82fd94
BLAKE2b-256 checksum
How to use checksums
41bbc53bd52f1a842ce6e567e895b764976f74f407fe2510698b2958cad34317
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp38-cp38-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl

Download URL fuzzysearch-0.8.1-cp38-cp38-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl
Size 55.9 kB
Tags CPython 3.8 Linux glibc 2.17+ x86-32 Linux glibc 2.5+ x86-32
SHA-256 checksum
How to use checksums
3d70532916e82ffc114554a1bb79b50073bc5c8584c99391457a1150c5e7e1e1
BLAKE2b-256 checksum
How to use checksums
1e145ce8449e46bfd06ae1cf19c51a61398845c21d76f6032d0b59693a267b4f
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp38-cp38-macosx_11_0_arm64.whl

Download URL fuzzysearch-0.8.1-cp38-cp38-macosx_11_0_arm64.whl
Size 32.3 kB
Tags CPython 3.8 macOS 11.0+ ARM64
SHA-256 checksum
How to use checksums
a19eb12081dee25f7ea05e01686b7edd4c7a0fe88d5580a195cd04a719f5f530
BLAKE2b-256 checksum
How to use checksums
218514b09bdac6aba87ec7b4f5d78e3658e78a90b50ebdfa16040ea1b6dfbab1
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release files / fuzzysearch-0.8.1-cp38-cp38-macosx_10_9_x86_64.whl

Download URL fuzzysearch-0.8.1-cp38-cp38-macosx_10_9_x86_64.whl
Size 31.6 kB
Tags CPython 3.8 macOS 10.9+ x86-64
SHA-256 checksum
How to use checksums
78f5104688951ba9511883a06e04568e5e2487857cd311f804864d5dfce3f63d
BLAKE2b-256 checksum
How to use checksums
c1a700547391db800b798f4f414c624a8d18793cbed1d33aec068cdef8f59804
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/6.1.0 CPython/3.13.7

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Nov 11, 2025.

Transparency log

Release history Release notifications | RSS feed

This release

0.8.1 This release

41 release files

0.8.0

41 release files

0.7.3

16 release files

0.7.0

18 release files

0.6.2

15 release files

0.3.0

6 release files

0.2.2

1 release file

0.2.1

1 release file

0.2.0

1 release file

0.1.0

1 release file

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page