fuzzysearch is useful for finding approximate subsequence matches
Free software: MIT license
Documentation: http://fuzzysearch.rtfd.org.
Features
Fuzzy sub-sequence search: Find parts of a sequence which match a given sub-sequence up to a given maximum Levenshtein distance.
Simple Example
You can usually just use the find_near_matches() utility function, which chooses a suitable fuzzy search implementation according to the given parameters:
>>> from fuzzysearch import find_near_matches
>>> find_near_matches('PATTERN', 'aaaPATERNaaa', max_l_dist=1)
[Match(start=3, end=9, dist=1)]Advanced Example
If needed you can choose a specific search implementation, such as find_near_matches_with_ngrams():
>>> sequence = '''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG'''
>>> subsequence = 'TGCACTGTAGGGATAACAAT' #distance 1
>>> max_distance = 2
>>> from fuzzysearch import find_near_matches_with_ngrams
>>> find_near_matches_with_ngrams(subsequence, sequence, max_distance)
[Match(start=3, end=24, dist=1)]History
0.2.1 (2014-03-14)
Fixed major match grouping bug
0.2.0 (2013-03-13)
New utility function find_near_matches() for easier use
Additional documentation
0.1.0 (2013-11-12)
Two working implementations
Extensive test suite; all tests passing
Full support for Python 2.6-2.7 and 3.1-3.3
Bumped status from Pre-Alpha to Alpha
0.0.1 (2013-11-01)
First release on PyPI.
1 maintainer
Metadata
1 maintainer
Release files for fuzzysearch 0.2.1
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| fuzzysearch-0.2.1.tar.gz | 9.3 kB | Details |
Release files / fuzzysearch-0.2.1.tar.gz
| Download URL | fuzzysearch-0.2.1.tar.gz |
|---|---|
| Size | 9.3 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
0e9a9ef80789f69c1e5f8b703329f86150f6562ba4dae52dccee76015fb3002d
|
|
BLAKE2b-256 checksum How to use checksums |
4feb635440f66b778e7e7f625b25c06a341979b430c38c02ab3584b41d1310c9
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
