fuzzysearch 0.2.2

fuzzysearch is useful for finding approximate subsequence matches

fuzzysearch is useful for finding approximate subsequence matches

• Free software: MIT license

• Documentation: http://fuzzysearch.rtfd.org.

Features

• Fuzzy sub-sequence search: Find parts of a sequence which match a given sub-sequence up to a given maximum Levenshtein distance.

Simple Example

You can usually just use the find_near_matches() utility function, which chooses a suitable fuzzy search implementation according to the given parameters:

>>> from fuzzysearch import find_near_matches
>>> find_near_matches('PATTERN', 'aaaPATERNaaa', max_l_dist=1)
[Match(start=3, end=9, dist=1)]

Advanced Example

If needed you can choose a specific search implementation, such as find_near_matches_with_ngrams():

>>> sequence = '''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG'''
>>> subsequence = 'TGCACTGTAGGGATAACAAT' #distance 1
>>> max_distance = 2

>>> from fuzzysearch import find_near_matches_with_ngrams
>>> find_near_matches_with_ngrams(subsequence, sequence, max_distance)
[Match(start=3, end=24, dist=1)]

History

0.2.2 (2014-03-27)

• Added support for searching through BioPython Seq objects

• Added specialized search function allowing only subsitutions and insertions

• Fixed several bugs

0.2.1 (2014-03-14)

• Fixed major match grouping bug

0.2.0 (2013-03-13)

• New utility function find_near_matches() for easier use

• Additional documentation

0.1.0 (2013-11-12)

• Two working implementations

• Extensive test suite; all tests passing

• Full support for Python 2.6-2.7 and 3.1-3.3

• Bumped status from Pre-Alpha to Alpha

0.0.1 (2013-11-01)

• First release on PyPI.