Genomic Benchmarks
Project description
Genomic Benchmarks 🧬🏋️✔️
In this repository, we collect benchmarks for classification of genomic sequences. It is shipped as a Python package, together with functions helping to download & manipulate datasets and train NN models.
Hackathon 2021-11-19
We have collected a list of genomic datasets and are now organizing the ML hackathon to train classifiers over them. Would you join us on Friday, November 19, 2021, 15:00 CET at CEITEC MU, Brno, Czechia 🇨🇿🇪🇺, or remotely? Free refreshment for all participants, swag for the winners. The event is both competitive (to prove your ML models are the best) and a learning opportunity (we will provide all the help we can).
- Final datasets and evaluation metrics will be provided on the day of the hackathon. In principle, they will be similar to datasets currently included in this package.
- You can participate both in person at CEITEC or remotely. More information at bit.ly/genomichackathon, sign up here. No prior knowledge about DNA/RNA/genetics needed (you must be able to code in Python and know ML basics).
- To participate on-site, you must be vaccinated, recovered or tested (O-N-T regulations analogical to German G3 apply). Please, bring FFP2 mask.
Install
Genomic Benchmarks can be installed as follows:
# maintained for and tested on Python version 3.8
git clone https://github.com/ML-Bioinfo-CEITEC/genomic_benchmarks.git
cd genomic_benchmarks
pip install --editable .
or, alternatively,
pip install git+https://github.com/ML-Bioinfo-CEITEC/genomic_benchmarks.git
To use it with papermill, TF or pytorch, install the corresponding dependencies:
# if you want to use jupyter and papermill
pip install jupyter>=1.0.0
pip install papermill>=2.3.0
# if you want to train NN with TF
pip install tensorflow>=2.6.0
pip install typing-extensions --upgrade # fixing TF installation issue
# if you want to train NN with torch
pip install torch>=1.10.0
pip install torchtext
For the package development, use Python 3.8 (ideally 3.8.9) and the environment described here.
Usage
Get the list of all datasets with the list_datasets
function
>>> from genomic_benchmarks.data_check import list_datasets
>>>
>>> list_datasets()
['demo_coding_vs_intergenomic_seqs', 'demo_mouse_enhancers', 'human_nontata_promoters', 'human_enhancers_cohn', 'demo_human_or_worm', 'human_enhancers_ensembl']
You can get basic information about the benchmark with info
function:
>>> from genomic_benchmarks.data_check import info
>>>
>>> info("human_nontata_promoters", version=0)
Dataset `human_nontata_promoters` has 2 classes: negative, positive.
All lenghts of genomic intervals equals 251.
Totally 36131 sequences have been found, 27097 for training and 9034 for testing.
train test
negative 12355 4119
positive 14742 4915
The function download_dataset
downloads the full-sequence form of the required benchmark (splitted into train and test sets, one folder for each class). If not specified otherwise, the data will be stored in .genomic_benchmarks
subfolder of your home directory. By default, the dataset is obtained from our cloud cache (use_cloud_cache=True
).
>>> from genomic_benchmarks.loc2seq import download_dataset
>>>
>>> download_dataset("human_nontata_promoters", version=0)
Downloading 1VdUg0Zu8yfLS6QesBXwGz1PIQrTW3Ze4 into /home/petr/.genomic_benchmarks/human_nontata_promoters.zip... Done.
Unzipping...Done.
PosixPath('/home/petr/.genomic_benchmarks/human_nontata_promoters')
Getting TensorFlow Dataset for the benchmark and displaying samples is straightforward:
>>> from pathlib import Path
>>> import tensorflow as tf
>>>
>>> BATCH_SIZE = 64
>>> SEQ_TRAIN_PATH = Path.home() / '.genomic_benchmarks' / 'human_nontata_promoters' / 'train'
>>> CLASSES = ['negative', 'positive']
>>>
>>> train_dset = tf.keras.preprocessing.text_dataset_from_directory(
... directory=SEQ_TRAIN_PATH,
... batch_size=BATCH_SIZE,
... class_names=CLASSES)
Found 27097 files belonging to 2 classes.
>>>
>>> list(train_dset)[0][0][0]
<tf.Tensor: shape=(), dtype=string, numpy=b'TCCTGCCTTTCCACTTGCACCAGTTTTCCCACCCCAGCCTCAGGGCGGGGCTGCCTCGTCACTTGTCTCGGGGCAGATCTGCCCTACACACGTTAGCGCCGCGCGCAAAGCAGCCCCGCAGCACCCAGGCGCCTCCTGGCGGCGCCGCGAAGGGGCGGGGCTGTCGGCTGCGCGTTGTGCGCTGTCCCAGGTTGGAAACCAGTGCCCCAGGCGGCGAGGAGAGCGGTGCCTTGCAGGGATGCTGCGGGCGG'>
See How_To_Train_CNN_Classifier_With_TF.ipynb for more detailed description how to train CNN classifier with TensorFlow.
Getting Pytorch Dataset and displaying samples is also easy:
>>> from genomic_benchmarks.dataset_getters.pytorch_datasets import HumanNontataPromoters
>>>
>>> dset = HumanNontataPromoters(split='train', version=0)
>>> dset[0]
('CAATCTCACAGGCTCCTGGTTGTCTACCCATGGACCCAGAGGTTCTTTGACAGCTTTGGCAACCTGTCCTCTGCCTCTGCCATCATGGGCAACCCCAAAGTCAAGGCACATGGCAAGAAGGTGCTGACTTCCTTGGGAGATGCCATAAAGCACCTGGATGATCTCAAGGGCACCTTTGCCCAGCTGAGTGAACTGCACTGTGACAAGCTGCATGTGGATCCTGAGAACTTCAAGGTGAGTCCAGGAGATGT', 0)
See How_To_Train_CNN_Classifier_With_Pytorch.ipynb for more detailed description how to train CNN classifier with Pytorch.
Introduction
[WHY ARE BENCHMARKS IMPORTANT?]
[WHAT BENCHMARKS ARE GENOMIC BENCHMARKS?]
Structure of package
- datasets: Each folder is one benchmark dataset (or a set of bechmarks in subfolders), see README.md for the format specification
- docs: Each folder contains a Python notebook that has been used for the dataset creation
- experiments: Training a simple neural network model(s) for each benchmark dataset, can be used as a baseline
- notebooks: Main use-cases demonstrated in a form of Jupyter notebooks
- src/genomic_benchmarks: Python module for datasets manipulation (downlading, checking, etc.)
- tests: Unit tests for
pytest
andpytest-cov
How to contribute
TBD
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.