Skip to main content
### Sequence Feature Detection and Mapping

This repository consists of two tools: Giraffe and Hippo. Giraffe includes a
set of javascripts that visualize sequences and sequence features, and a Django
app that detects features, restriction sites, and ORFs from a sequence. You can
use the javascripts independently from the Django program. Hippo is a Django
frontend for managing NCBI blast databases. User can create sequences, assign
them to databases, and use Django management commands to build NCBI blast
databases. Giraffe uses NCBI blast databases, for example, to detect features
in a sequence.

Hippo and Giraffe provide a convenient way to use Blast for your own
application. You can build blast databases using Hippo, then use Giraffe to
blast query sequence against the database. Hippo offers a Django admin UI to
manage the blast DB, while Giraffe handles calling blast, parsing blast
results, and visualizing detected features.

This software was originally written by Misha Wolfson and Benjie Chen,
copyrighted by Addgene, and released under the MIT License. See LICENSE file.
It is now maintained by Benjie Chen.


### Giraffe - Visualization

You can use Giraffe javascripts independently of the Django service, to
visualize a sequence you already have a list of features for.

See src/giraffe/templates/giraffe/{analyze,draw}.html.


### Giraffe - Sequence feature detection

Requirements:

* System requirements: see provison/provision.sh (you can use this to
provision a Vagrant instance, e.g.)

* Python requirements: pip install -r requirements.txt
(Currently supports Django 1.5 or higher)

* NCBI: install NCBI Blast toolkit (this takes awhile): cd ncbi; . install


Install Django service and build default database:

```
git clone git@github.com:benjiec/giraffe.git
cd giraffe
(cd src; python manage.py migrate)
(cd src; python manage.py build_blastdb)
```

Run test server:

```
cd src; python manage.py runserver 0.0.0.0:8000
```

Then goto http://0.0.0.0:8000/giraffe/demo/


### API

You can POST a sequence to "/giraffe/analyze/", with the following params:

```
db=default&sequence=your_dna_sequence_or_genbank_sequence_here
```

This will return a JSON array of [sequence_len, array of features, sequence].

Programmatically, you can construct new blast databases using Hippo. E.g.

```
from hippo.models import Feature, Feature_Type, Feature_Database
db = Feature_Database(name='my_db')
db.save()
ft = Feature_Type.objects.get(type='Promoter')
feature = Feature(type=ft, name='Promoter1', sequence='AGCTATTTCGGAGTCGGCGATTACGATCGGCGATCG')
feature.save()
db.features.add(feature)
db.build()
```

You can then query against database. E.g.

```
from hippo.models import Feature_Database
from giraffe.features import blast

db = Feature_Database.objects.get(name='my_db')
query = '...' # some query sequence
features = blast(query, db)
```


### Hippo as a BLAST frontend

Use Django admin to add features, group features into databases. Use the
build_blastdb django management command to build your databases, then Giraffe
can use the databases for feature detection. Alternatively, call the
```build``` method on a ```Feature_Database object``` directly.

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

giraffe-2.0.tar.gz (15.9 kB view details)

Uploaded Source

File details

Details for the file giraffe-2.0.tar.gz.

File metadata

  • Download URL: giraffe-2.0.tar.gz
  • Upload date:
  • Size: 15.9 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No

File hashes

Hashes for giraffe-2.0.tar.gz
Algorithm Hash digest
SHA256 31f4ae14985a2eb65bd13b918b9490d792972b3064b8d6d9e6741bb1ad15d067
MD5 7320361848856f7caad3a1e5b3eaa7d6
BLAKE2b-256 368c99b1d3aa3d5d5de218bc294d950ed61c8bf584595a73ca63ba85a05173ed

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

2.0 This release

1 file

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page