### Sequence Feature Detection and Mapping
This repository consists of two tools: Giraffe and Hippo. Giraffe includes a
set of javascripts that visualize sequences and sequence features, and a Django
app that detects features, restriction sites, and ORFs from a sequence. You can
use the javascripts independently from the Django program. Hippo is a Django
frontend for managing NCBI blast databases. User can create sequences, assign
them to databases, and use Django management commands to build NCBI blast
databases. Giraffe uses NCBI blast databases, for example, to detect features
in a sequence.
Hippo and Giraffe provide a convenient way to use Blast for your own
application. You can build blast databases using Hippo, then use Giraffe to
blast query sequence against the database. Hippo offers a Django admin UI to
manage the blast DB, while Giraffe handles calling blast, parsing blast
results, and visualizing detected features.
This software was originally written by Misha Wolfson and Benjie Chen,
copyrighted by Addgene, and released under the MIT License. See LICENSE file.
It is now maintained by Benjie Chen.
### Giraffe - Visualization
You can use Giraffe javascripts independently of the Django service, to
visualize a sequence you already have a list of features for.
See src/giraffe/templates/giraffe/{analyze,draw}.html.
### Giraffe - Sequence feature detection
Requirements:
* System requirements: see provison/provision.sh (you can use this to
provision a Vagrant instance, e.g.)
* Python requirements: pip install -r requirements.txt
(Currently supports Django 1.5 or higher)
* NCBI: install NCBI Blast toolkit (this takes awhile): cd ncbi; . install
Install Django service and build default database:
```
git clone git@github.com:benjiec/giraffe.git
cd giraffe
(cd src; python manage.py migrate)
(cd src; python manage.py build_blastdb)
```
Run test server:
```
cd src; python manage.py runserver 0.0.0.0:8000
```
Then goto http://0.0.0.0:8000/giraffe/demo/
### API
You can POST a sequence to "/giraffe/analyze/", with the following params:
```
db=default&sequence=your_dna_sequence_or_genbank_sequence_here
```
This will return a JSON array of [sequence_len, array of features, sequence].
Programmatically, you can construct new blast databases using Hippo. E.g.
```
from hippo.models import Feature, Feature_Type, Feature_Database
db = Feature_Database(name='my_db')
db.save()
ft = Feature_Type.objects.get(type='Promoter')
feature = Feature(type=ft, name='Promoter1', sequence='AGCTATTTCGGAGTCGGCGATTACGATCGGCGATCG')
feature.save()
db.features.add(feature)
db.build()
```
You can then query against database. E.g.
```
from hippo.models import Feature_Database
from giraffe.features import blast
db = Feature_Database.objects.get(name='my_db')
query = '...' # some query sequence
features = blast(query, db)
```
### Hippo as a BLAST frontend
Use Django admin to add features, group features into databases. Use the
build_blastdb django management command to build your databases, then Giraffe
can use the databases for feature detection. Alternatively, call the
```build``` method on a ```Feature_Database object``` directly.
This repository consists of two tools: Giraffe and Hippo. Giraffe includes a
set of javascripts that visualize sequences and sequence features, and a Django
app that detects features, restriction sites, and ORFs from a sequence. You can
use the javascripts independently from the Django program. Hippo is a Django
frontend for managing NCBI blast databases. User can create sequences, assign
them to databases, and use Django management commands to build NCBI blast
databases. Giraffe uses NCBI blast databases, for example, to detect features
in a sequence.
Hippo and Giraffe provide a convenient way to use Blast for your own
application. You can build blast databases using Hippo, then use Giraffe to
blast query sequence against the database. Hippo offers a Django admin UI to
manage the blast DB, while Giraffe handles calling blast, parsing blast
results, and visualizing detected features.
This software was originally written by Misha Wolfson and Benjie Chen,
copyrighted by Addgene, and released under the MIT License. See LICENSE file.
It is now maintained by Benjie Chen.
### Giraffe - Visualization
You can use Giraffe javascripts independently of the Django service, to
visualize a sequence you already have a list of features for.
See src/giraffe/templates/giraffe/{analyze,draw}.html.
### Giraffe - Sequence feature detection
Requirements:
* System requirements: see provison/provision.sh (you can use this to
provision a Vagrant instance, e.g.)
* Python requirements: pip install -r requirements.txt
(Currently supports Django 1.5 or higher)
* NCBI: install NCBI Blast toolkit (this takes awhile): cd ncbi; . install
Install Django service and build default database:
```
git clone git@github.com:benjiec/giraffe.git
cd giraffe
(cd src; python manage.py migrate)
(cd src; python manage.py build_blastdb)
```
Run test server:
```
cd src; python manage.py runserver 0.0.0.0:8000
```
Then goto http://0.0.0.0:8000/giraffe/demo/
### API
You can POST a sequence to "/giraffe/analyze/", with the following params:
```
db=default&sequence=your_dna_sequence_or_genbank_sequence_here
```
This will return a JSON array of [sequence_len, array of features, sequence].
Programmatically, you can construct new blast databases using Hippo. E.g.
```
from hippo.models import Feature, Feature_Type, Feature_Database
db = Feature_Database(name='my_db')
db.save()
ft = Feature_Type.objects.get(type='Promoter')
feature = Feature(type=ft, name='Promoter1', sequence='AGCTATTTCGGAGTCGGCGATTACGATCGGCGATCG')
feature.save()
db.features.add(feature)
db.build()
```
You can then query against database. E.g.
```
from hippo.models import Feature_Database
from giraffe.features import blast
db = Feature_Database.objects.get(name='my_db')
query = '...' # some query sequence
features = blast(query, db)
```
### Hippo as a BLAST frontend
Use Django admin to add features, group features into databases. Use the
build_blastdb django management command to build your databases, then Giraffe
can use the databases for feature detection. Alternatively, call the
```build``` method on a ```Feature_Database object``` directly.
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
giraffe-2.0.tar.gz
(15.9 kB
view details)
File details
Details for the file giraffe-2.0.tar.gz.
File metadata
- Download URL: giraffe-2.0.tar.gz
- Upload date:
- Size: 15.9 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
31f4ae14985a2eb65bd13b918b9490d792972b3064b8d6d9e6741bb1ad15d067
|
|
| MD5 |
7320361848856f7caad3a1e5b3eaa7d6
|
|
| BLAKE2b-256 |
368c99b1d3aa3d5d5de218bc294d950ed61c8bf584595a73ca63ba85a05173ed
|