Skip to main content

Protein & Interactomic Graph Construction for Machine Learning

Project description

Docs DOI:10.1101/2020.07.15.204701 Project Status: Active – The project has reached a stable, usable state and is being actively developed. CodeFactor Quality Gate Status Bugs Maintainability Rating Reliability Rating Gitter chat License: MIT Code style: black banner

Documentation | Paper | Tutorials

Protein & Interactomic Graph Library

This package provides functionality for producing geometric representations of protein and RNA structures, and biological interaction networks. We provide compatibility with standard PyData formats, as well as graph objects designed for ease of use with popular deep learning libraries.

What's New?

Example usage

Creating a Protein Graph

Tutorial (Residue-level) | Tutorial - Atomic | Docs

from graphein.protein.config import ProteinGraphConfig
from graphein.protein.graphs import construct_graph

config = ProteinGraphConfig()
g = construct_graph(config=config, pdb_code="3eiy")

Creating a Protein Graph from the AlphaFold Protein Structure Database

Tutorial | Docs

from graphein.protein.config import ProteinGraphConfig
from graphein.protein.graphs import construct_graph
from graphein.protein.utils import download_alphafold_structure

config = ProteinGraphConfig()
fp = download_alphafold_structure("Q5VSL9", aligned_score=False)
g = construct_graph(config=config, pdb_path=fp)

Creating a Protein Mesh

Tutorial | Docs

from graphein.protein.config import ProteinMeshConfig
from graphein.protein.meshes import create_mesh

verts, faces, aux = create_mesh(pdb_code="3eiy", config=config)

Creating an RNA Graph

Tutorial | Docs

from graphein.rna.graphs import construct_rna_graph
# Build the graph from a dotbracket & optional sequence
rna = construct_rna_graph(dotbracket='..(((((..(((...)))..)))))...',
                          sequence='UUGGAGUACACAACCUGUACACUCUUUC')

Creating a Protein-Protein Interaction Graph

Tutorial | Docs

from graphein.ppi.config import PPIGraphConfig
from graphein.ppi.graphs import compute_ppi_graph
from graphein.ppi.edges import add_string_edges, add_biogrid_edges

config = PPIGraphConfig()
protein_list = ["CDC42", "CDK1", "KIF23", "PLK1", "RAC2", "RACGAP1", "RHOA", "RHOB"]

g = compute_ppi_graph(config=config,
                      protein_list=protein_list,
                      edge_construction_funcs=[add_string_edges, add_biogrid_edges]
                     )

Creating a Gene Regulatory Network Graph

Tutorial | Docs

from graphein.grn.config import GRNGraphConfig
from graphein.grn.graphs import compute_grn_graph
from graphein.grn.edges import add_regnetwork_edges, add_trrust_edges

config = GRNGraphConfig()
gene_list = ["AATF", "MYC", "USF1", "SP1", "TP53", "DUSP1"]

g = compute_grn_graph(
    gene_list=gene_list,
    edge_construction_funcs=[
        partial(add_trrust_edges, trrust_filtering_funcs=config.trrust_config.filtering_functions),
        partial(add_regnetwork_edges, regnetwork_filtering_funcs=config.regnetwork_config.filtering_functions),
    ],
)

Installation

The dev environment includes GPU Builds (CUDA 11.1) for each of the deep learning libraries integrated into graphein.

git clone https://www.github.com/a-r-j/graphein
cd graphein
conda create env -f environment-dev.yml
pip install -e .

A lighter install can be performed with:

git clone https://www.github.com/a-r-j/graphein
cd graphein
conda create env -f environment.yml
pip install -e .

Citing Graphein

Please consider citing graphein if it proves useful in your work.

@article{Jamasb2020,
  doi = {10.1101/2020.07.15.204701},
  url = {https://doi.org/10.1101/2020.07.15.204701},
  year = {2020},
  month = jul,
  publisher = {Cold Spring Harbor Laboratory},
  author = {Arian Rokkum Jamasb and Pietro Lio and Tom Blundell},
  title = {Graphein - a Python Library for Geometric Deep Learning and Network Analysis on Protein Structures}
}

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

graphein-1.0.1.tar.gz (98.8 kB view hashes)

Uploaded Source

Built Distribution

graphein-1.0.1-py2.py3-none-any.whl (103.6 kB view hashes)

Uploaded Python 2 Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page