Package for designing headloop primers to use in headloop suppression PCR to suppress amplification of a known haplotype.
Project description
Headloop
Package for designing headloop primers to use in headloop suppression PCR to suppress amplification of a known haplotype. Copyright (C) July 2020, Gareth T. Powell
License
This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details.
You should have received a copy of the GNU General Public License along with this program. If not, see https://www.gnu.org/licenses/.
Description
Function designs tags from guide sequence provided by the user, with frameshifting to minimise Tm differences between the tags and the PCR primers, then adds the 'best' tags to the correct PCR primer provided by the user, depending upon strand orientation of the guide sequence relative to the PCR primers e.g. if the guide sequence in on the same strand as the sense primer, a reverse complement tag is added to the sense primer and an offset tag is added to the antisense primer.
For further details of headloop suppression PCR, see the paper at eLife:
Kroll, F., Powell, G.T. et al (2021) eLife 10:e59683, doi: 10.7554/eLife.59683
https://doi.org/10.7554/eLife.59683
Installation
pip install headloop
This package uses 'melting' from Erik Clarke [https://github.com/eclarke/melt] to calculate Tm of primers and headloop tags, and Seq & SeqRecord from Biopython [https://biopython.org/wiki/Seq] for reverse complementation and object input/output.
Usage
To use this package, the user needs to provide four variables:
sense_oligo #string containing the sense primer
antisense_oligo #string containing the antisense primer
guide_context #string containing guide sequence and >= 15 bp forward context
orientation #is the guide in the same strand as the 'sense' primer or 'antisense' primer?
Example (tbx16_AA):
from headloop.designer import design
design('CTGGTCCAGTGCGTTATTGG', 'AGCCAAATGCTTCTTGCTCTTTT',
'CTACAGGACGTACCTGCACCCGGATTCACCAGCGCCCG', 'antisense')
Returns: Two primers as SeqRecord objects, with comments on Tm matching in the description
CCTGCACCCGGATTCACCAGCTGGTCCAGTGCGTTATTGG
WARNING: Could not optimise sense headloop tag (Tm difference > 3°C)
GGTGCAGGTACGTCCTGTAGAGCCAAATGCTTCTTGCTCTTTT
Tm difference < 3°C
(Gives a warning flag if the Tm difference between the headloop tag and the
base primer is calculated to be > 3C)
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Hashes for headloop-1.0.11-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | 6dc795035b75d51bcb82899241b238426aff962a844aafbe5499fec5a22fb479 |
|
MD5 | be78599de62ffd3d363ee0733d3429d4 |
|
BLAKE2b-256 | ca2e22d17fd228b4c316ae289256e9781dd02ad7f8a82f7c4ed9087e73543b61 |