HiTaC
HiTaC is an open-source hierarchical taxonomic classifier for fungal ITS sequences.
Quick links
- Benchmark
- Install standalone version
- Quick start for standalone version
- Install as a QIIME2 plugin
- Quick start for QIIME2 plugin
- Pre-trained models
- Support
- Contributing
- Getting the latest updates
- Citation
Benchmark
HiTaC was thoroughly evaluated with the TAXXI benchmark, consistently achieving higher accuracy and sensitivity as evidenced in the figures below.
For reproducibility, a Snakemake pipeline was created. Instructions on how to run it and source code are available at https://github.com/mirand863/hitac/tree/main/benchmark.
Install standalone version
Option 1: Conda
HiTaC can be easily installed in a new conda environment by running the following command:
conda create -n hitac -c bioconda hitac
Afterward, the new conda environment created can be activated with:
conda activate hitac
For conda installation instructions, we refer the reader to Conda's user guide.
Option 2: Pip
Alternatively, HiTaC can be installed with pip by running:
pip install hitac
Option 3: Docker
Lastly, HiTaC can be downloaded as a docker image:
docker pull mirand863/hitac_standalone:latest
The downloaded image can then be started with:
docker run -it mirand863/hitac_standalone:latest /bin/bash
Quick start for standalone version
For an interactive tutorial, we refer the reader to our Google Colabs notebook.
To see the usage run [command] --help if you want further help with a specific command.
usage: hitac-fit [-h] --reference REFERENCE [--kmer KMER] [--threads THREADS] --classifier CLASSIFIER
Fit hierarchical classifier
optional arguments:
-h, --help show this help message and exit
--reference REFERENCE
Input FASTA file with reference sequence(s) to train model
--kmer KMER K-mer size for feature extraction [default: 6]
--threads THREADS Number of threads to train in parallel [default: all]
--classifier CLASSIFIER
Path to store trained hierarchical classifier
Input Files
HiTaC accepts reference and query files in FASTA format. The reference file must have the taxonomies annotated as follows:
>EU272527;tax=d:Fungi,p:Ascomycota,c:Eurotiomycetes,o:Eurotiales,f:Trichocomaceae,g:Paecilomyces,s:Paecilomyces_sinensis;
CCGAGTGAGGGTCCCACGAGGCCCAACCTCCCATCCGTGTTGAACTACACCTGTTGCTTCGGCGGGCCCGCCGTGGTTCA
CGCCCGGCCGCCGGGGGGCCTTGTGCTCCCGGGCCCGCGCCCGCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGT
CTGAGTATAAAATCAATCATTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCG
ATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCA
TGCCTGTCCGAGCGTCATTGCTAACCCTCCAGCCCGGCTGGTGTGTTGGGTCGACGTCCCCCCCGGGGGACGGGCCCGAA
AGGCAGCGGCGGCGCCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACGCGCTCTGGTAGGGTCGGCCGGCTGGCCAG
CCAGCGACCTCACGGTCACCTATTTTTTCTCTTAGG
>L54118;tax=d:Fungi,p:Basidiomycota,c:Agaricomycetes,o:Boletales,f:Suillaceae,g:Suillus,s:Suillus_placidus;
ACGAATTCATAATTCGGCGAGGGGAAAGCGGAGGGTTGTAGCTGGCCTTTTTACCGAGGCACGTGCACGCTCTCTTCCGA
ACTCTCGTCGTATGGGCGCGGGGCGACCCGCGTCTTTCATCCCACCTCTTCGTGTAGAAAGTCTTTGAATGTTTTTACCA
TCATCGAGTCGCGACTTCTAGGAGACGCGATTCTTTGAGACAAAAGTTTATTACAACTTTCAGCAATGGATCTCTTGGCT
CTCGCATCGATGAAGAACGCAGCGAATCGCGATATGTAATGTGAATTGCAGATCTACAGTGAATCATCGAATCTTTGAAC
GCACCTTGCGCTCCTCGGTGTTCCGAGGAGCATGCCTGTTTGAGCGTCAGTAAATTCTCAACCCCTCTCGATTTGCTTCG
AGAGGGCGCTTGGATGGTGGGGGCTGCCGGAGACCTGGATTTATCCCTGGACTCGGGCTCTCCTGAAATGCATCGGCTTG
CGGTCGACTTTCGACTTTGCGCGACAAGGCCTTCGGCGTGATAATGATCGCCGTTCGCCGAAGCGCAGGAATGAACGGTC
CCGCGCCTCTAATCCGTCGACGCTTTCGAGCGTCTTCCTCATTGACGTTTGACCTCAAAT
Training and predicting taxonomies
To train the model and classify, simply run:
hitac-fit \
--reference reference.fasta \
--classifier classifier.pkl
hitac-classify \
--classifier classifier.pkl \
--reads reads.fasta \
--classification classification.tsv
Additionally, a filter can be trained to remove ranks where the predictions might be inaccurate and to compute the confidence score:
hitac fit-filter \
--reference reference.fasta \
--filter filter.pkl
hitac filter \
--filter filter.pkl \
--reads reads.fasta \
--classification classification.tsv \
--filtered-classification filtered_classification.tsv
Output File
HiTaC generates a TSV file for the predictions. The first column in the TSV file contains the identifier of the test sequence and the second column holds the predictions made by HiTaC. For example:
EU254776 d:Fungi,p:Ascomycota,c:Sordariomycetes,o:Diaporthales,f:Valsaceae,g:Cryptosporella,s:Cryptosporella_femoralis
FJ711636 d:Fungi,p:Basidiomycota,c:Agaricomycetes,o:Agaricales,f:Marasmiaceae,g:Armillaria,s:Armillaria_tabescens
UDB016040 d:Fungi,p:Basidiomycota,c:Agaricomycetes,o:Russulales,f:Russulaceae,g:Russula,s:Russula_adusta
GU827310 d:Fungi,p:Ascomycota,c:Lecanoromycetes,o:Lecanorales,f:Ramalinaceae,g:Ramalina,s:Ramalina_conduplicans
JN943699 d:Fungi,p:Ascomycota,c:Lecanoromycetes,o:Lecanorales,f:Parmeliaceae,g:Punctelia,s:Punctelia_caseana
Install as a QIIME2 plugin
Option 1: Conda
HiTaC can also be installed as a QIIME 2 plugin. To install QIIME 2 version 2023.2 in a GNU/Linux machine, run:
wget https://data.qiime2.org/distro/core/qiime2-2023.2-py38-linux-conda.yml
conda env create -n hitac --file qiime2-2023.2-py38-linux-conda.yml
# OPTIONAL CLEANUP
rm qiime2-2023.2-py38-linux-conda.yml
Note: Instructions on how to install on Windows and macOS are available at QIIME 2 docs.
Afterward, the new conda environment created in the last step can be activated and HiTaC can be installed:
conda activate hitac
conda install -c conda-forge -c bioconda hitac
For conda installation instructions, we refer the reader to Conda's user guide.
Option 2: Pip
Alternatively, HiTaC can be installed with pip in an environment where QIIME 2 was previously installed:
pip install hitac
Option 3: Docker
Lastly, HiTaC and all its dependencies can be downloaded as a docker image:
docker pull mirand863/hitac_qiime:latest
The downloaded image can then be started with:
docker run -it mirand863/hitac_qiime:latest /bin/bash
Quick start for QIIME2 plugin
For an interactive tutorial, we refer the reader to our Google Colabs notebook.
To see the usage run qiime hitac --help or qiime hitac [command] --help if you want further help with a specific command.
Usage: qiime hitac [OPTIONS] COMMAND [ARGS]...
Description: This QIIME 2 plugin wraps HiTaC for hierarchical taxonomic
classification.
Plugin website: https://gitlab.com/dacs-hpi/hitac
Getting user support: Please post to the QIIME 2 forum for help with this
plugin: https://forum.qiime2.org
Options:
--version Show the version and exit.
--citations Show citations and exit.
--help Show this message and exit.
Commands:
classify Hierarchical classification with HiTaC's pre-fitted model
filter Hierarchical classification filtering with HiTaC's pre-fitted
model
fit Train HiTaC's hierarchical classifier
fit-filter Train HiTaC's hierarchical filter
Input Files
HiTaC accepts taxonomy in TSV format and training and test files in FASTA format. All these files must be previously imported by QIIME 2, for example:
qiime tools import \
--input-path query.fasta \
--output-path query.qza \
--type 'FeatureData[Sequence]'
qiime tools import \
--input-path reference.fasta \
--output-path reference.qza \
--type 'FeatureData[Sequence]'
qiime tools import \
--type 'FeatureData[Taxonomy]' \
--input-format HeaderlessTSVTaxonomyFormat \
--input-path taxonomy.txt \
--output-path taxonomy.qza
Training and predicting taxonomies
To train the model and classify, simply run:
qiime hitac fit \
--i-reference-reads reference.qza \
--i-reference-taxonomy taxonomy.qza \
--o-classifier classifier.qza
qiime hitac classify \
--i-classifier classifier.qza \
--i-reads query.qza \
--o-classification classification.qza
Additionally, a filter can be trained to remove ranks where the predictions might be inaccurate and to compute the confidence score:
qiime hitac fit-filter \
--i-reference-reads reference.qza \
--i-reference-taxonomy taxonomy.qza \
--o-filter filter.qza
qiime hitac filter \
--i-filter filter.qza \
--i-reads query.qza \
--i-classification classification.qza \
--o-filtered-classification filtered_classification.qza
Output File
The predictions can be exported from QIIME 2 to a TSV file:
qiime tools export \
--input-path classification.qza \
--output-path output_dir
or alternativelly if the filter was used:
qiime tools export \
--input-path filter_output.qza \
--output-path output_dir
The first column in the TSV file contains the identifier of the test sequence, while the second column holds the predictions made by HiTaC and the third column is the prediction probability if the filter was applied. For example:
Feature ID Taxon Confidence
EU254776 d__Fungi; p__Ascomycota; c__Sordariomycetes; o__Diaporthales; f__Valsaceae; g__Cryptosporella -1
FJ711636 d__Fungi; p__Basidiomycota; c__Agaricomycetes; o__Agaricales; f__Marasmiaceae; g__Armillaria -1
UDB016040 d__Fungi; p__Basidiomycota; c__Agaricomycetes; o__Russulales; f__Russulaceae; g__Russula -1
GU827310 d__Fungi; p__Ascomycota; c__Lecanoromycetes; o__Lecanorales; f__Ramalinaceae; g__Ramalina -1
JN943699 d__Fungi; p__Ascomycota; c__Lecanoromycetes; o__Lecanorales; f__Parmeliaceae; g__Punctelia -1
Quick start for QIIME2 plugin
In order to speed up the process for users, we provide pre-trained models on the public database UNITE. Some of these pre-trained models contain all eukaryotic ITS sequences available on UNITE, which enable detection and removal of nonfungal sequences mistakenly amplified by polymerase chain reaction (PCR). Furthermore, HiTaC uses the unique species hypotheses identifiers provided in the database UNITE as the last taxonomic level in the hierarchy during training and reports them to the user, which increases taxonomic reproducibility.
- Pre-trained QIIME2 models for HiTaC (UNITE all eukaryotes)
- Pre-trained QIIME2 models for HiTaC (UNITE only fungi)
- Pre-trained QIIME2 models for HiTaC_Filter (UNITE all eukaryotes)
- Pre-trained QIIME2 models for HiTaC_Filter (UNITE only fungi)
- Pre-trained standalone models for HiTaC (UNITE all eukaryotes)
- Pre-trained standalone models for HiTaC (UNITE only fungi)
- Pre-trained standalone models for HiTaC_Filter (UNITE all eukaryotes)
- Pre-trained standalone models for HiTaC_Filter (UNITE only fungi)
Support
If you run into any problems or issues, please create a GitLab issue and we will try our best to help.
We strive to provide good support through our issue tracker on GitLab. However, if you'd like to receive private support with:
- Phone / video calls to discuss your specific use case and get recommendations
- Private discussions over Slack or Mattermost
Please reach out to fabio.malchermiranda@hpi.de.
Contributing
We are a small team on a mission to improve ITS taxonomic classification, and we will take all the help we can get! If you would like to get involved, here is information on contribution guidelines and how to test the code locally.
You can contribute in multiple ways, e.g., reporting bugs, writing or translating documentation, reviewing or refactoring code, requesting or implementing new features, etc.
Getting the latest updates
If you'd like to get updates when we release new versions, please click on the notification button on the top and select "Watch". GitLab will then send you notifications along with a changelog with each new release.
Citation
If you use HiTaC, please cite:
Miranda, Fábio M., et al. "HiTaC: Hierarchical Taxonomic Classification of Fungal ITS Sequences." bioRxiv (2020).
@article{miranda2020hitac,
title={HiTaC: Hierarchical Taxonomic Classification of Fungal ITS Sequences},
author={Miranda, F{\'a}bio M and Azevedo, Vasco AC and Renard, Bernhard Y and Piro, Vitor C and Ramos, Rommel TJ},
journal={bioRxiv},
year={2020},
publisher={Cold Spring Harbor Laboratory}
}
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file hitac-2.2.2.tar.gz.
File metadata
- Download URL: hitac-2.2.2.tar.gz
- Upload date:
- Size: 43.5 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/5.0.0 CPython/3.12.2
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
22e69ba328f4d48b6f1dd6c394f37fdc429317a5a810a41c91e8e03454f8db09
|
|
| MD5 |
d1cb375a8b4b33b00cd60873e0a030e9
|
|
| BLAKE2b-256 |
a9aeb7d116dd65bd41d8a48c60a00165abc46c120bb5d4aa869b5a9f59630f77
|
File details
Details for the file hitac-2.2.2-py3-none-any.whl.
File metadata
- Download URL: hitac-2.2.2-py3-none-any.whl
- Upload date:
- Size: 21.1 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/5.0.0 CPython/3.12.2
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
0d22e2e39540646cdb372bcf4ce258d16055836f0956907dfdb2e71a9a9c63f7
|
|
| MD5 |
e2a0282fa77252db9f01bda8a10d54e5
|
|
| BLAKE2b-256 |
6aac0e2c1100ac117638d1818a6c674f5ed5431bf5ae1bfe1be9f5fcb4720e29
|