HotKnots

Fast, and best, DNA/RNA folding algorithm

This was my attempt to get an RNA/DNA secondary structure program that included pseudoknot structures working as a Python C Extenstion.

I tried several different algoritms/packages, and Hotknots was not only the fastest, but also the only that actually did pseudoknots.

I got it mostly working, but have not gottten around to making the parameter files as internal variables. Having extenal data files with python PIP pacakges is a hassle due to operating environments being virtual and not having actual file system paths. Currently the params folder has to be in the same folder that you run HotKnots

To install:

git clone https://github.com/deprekate/HotKnots.git
pip install HotKnots/ --user

To use on the command line:

echo AACCCCUGCUGAAUAAAGCGGGGAAUAACUAUUCUAC | hotknots.py

and the output should be the sequence, followed by the structure and mfe of the best folding

AACCCCUGCUGAAUAAAGCGGGGAAUAACUAUUCUAC
...((((((([[[[[.)))))))......]]]]]... -9.883

To import and use in other python code, you need to import the package, and then find out where it is installed, so it can find the various parameter files. This is also when you can specify which model and paramters to use:

import HotKnots as hk
# initialize everything first
params = os.path.dirname(hk.__file__)
hk.initialize( "DP", os.path.join(params,"parameters_DP09.txt") , os.path.join(params,"multirnafold.conf"), os.path.join(params,"pkenergy.conf") )

print(hk.fold("AACCCCUGCUGAAUAAAGCGGGGAAUAACUAUUCUAC", "DP"))