Skip to main content

A a tool to predict RNA secondary structure, including pseudoknots

Project description

HotKnots

Fast, and best, DNA/RNA folding algorithm

This was my attempt to get an RNA/DNA secondary structure program that included pseudoknot structures working as a Python C Extenstion.

I tried several different algoritms/packages, and Hotknots was not only the fastest, but also the only that actually did pseudoknots.

I got it mostly working, but have not gottten around to making the parameter files as internal variables. Having extenal data files with python PIP pacakges is a hassle due to operating environments being virtual and not having actual file system paths. Currently the params folder has to be in the same folder that you run HotKnots

To install:

git clone https://github.com/deprekate/HotKnots.git
pip install HotKnots/ --user

To use on the command line:

echo AACCCCUGCUGAAUAAAGCGGGGAAUAACUAUUCUAC | hotknots.py

and the output should be the sequence, followed by the structure and mfe of the best folding

AACCCCUGCUGAAUAAAGCGGGGAAUAACUAUUCUAC
...((((((([[[[[.)))))))......]]]]]... -9.883

To import and use in other python code, you need to import the package, and then find out where it is installed, so it can find the various parameter files. This is also when you can specify which model and paramters to use:

import HotKnots as hk
# initialize everything first
params = os.path.dirname(hk.__file__)
hk.initialize( "DP", os.path.join(params,"parameters_DP09.txt") , os.path.join(params,"multirnafold.conf"), os.path.join(params,"pkenergy.conf") )

print(hk.fold("AACCCCUGCUGAAUAAAGCGGGGAAUAACUAUUCUAC", "DP"))

Project details


Release history Release notifications | RSS feed

This version

2.4

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

hotknots-2.4.tar.gz (435.3 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

hotknots-2.4-cp38-cp38-macosx_10_14_x86_64.whl (603.6 kB view details)

Uploaded CPython 3.8macOS 10.14+ x86-64

File details

Details for the file hotknots-2.4.tar.gz.

File metadata

  • Download URL: hotknots-2.4.tar.gz
  • Upload date:
  • Size: 435.3 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.6.0 importlib_metadata/4.8.2 pkginfo/1.8.1 requests/2.21.0 requests-toolbelt/0.9.1 tqdm/4.61.0 CPython/3.8.2

File hashes

Hashes for hotknots-2.4.tar.gz
Algorithm Hash digest
SHA256 f9e8b14dc77c250735117452ea57f09c550d2cd56f5403ef0175a1c75cccc5a3
MD5 fa9a2ff22caa1ab9c96c5d1b08e8038a
BLAKE2b-256 66138e7f5a2afeb2fa51c9e8b81a4bbc5d75c0b5e35f403f09ab76e4495c6140

See more details on using hashes here.

File details

Details for the file hotknots-2.4-cp38-cp38-macosx_10_14_x86_64.whl.

File metadata

  • Download URL: hotknots-2.4-cp38-cp38-macosx_10_14_x86_64.whl
  • Upload date:
  • Size: 603.6 kB
  • Tags: CPython 3.8, macOS 10.14+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.6.0 importlib_metadata/4.8.2 pkginfo/1.8.1 requests/2.21.0 requests-toolbelt/0.9.1 tqdm/4.61.0 CPython/3.8.2

File hashes

Hashes for hotknots-2.4-cp38-cp38-macosx_10_14_x86_64.whl
Algorithm Hash digest
SHA256 cc55e00447864849c539a3acb1cdba6c34d9cb38f9cf1ea99cbfe8e875de7f5a
MD5 0f9733732081e64babcb2a6614c44eb8
BLAKE2b-256 48e31068c7ff2648921adfa12727976509ddb9044e3c73c776f237ed3d93f279

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page