HotKnots
Fast, and best, DNA/RNA folding algorithm
This was my attempt to get an RNA/DNA secondary structure program that included pseudoknot structures working as a Python C Extenstion.
I tried several different algoritms/packages, and Hotknots was not only the fastest, but also the only that actually did pseudoknots.
I got it mostly working, but have not gottten around to making the parameter files as internal variables. Having extenal data files with python PIP pacakges is a hassle due to operating environments being virtual and not having actual file system paths. Currently the params folder has to be in the same folder that you run HotKnots
To install:
git clone https://github.com/deprekate/HotKnots.git
pip install HotKnots/ --user
To use on the command line:
echo AACCCCUGCUGAAUAAAGCGGGGAAUAACUAUUCUAC | hotknots.py
and the output should be the sequence, followed by the structure and mfe of the best folding
AACCCCUGCUGAAUAAAGCGGGGAAUAACUAUUCUAC
...((((((([[[[[.)))))))......]]]]]... -9.883
To import and use in other python code, you need to import the package, and then find out where it is installed, so it can find the various parameter files. This is also when you can specify which model and paramters to use:
import HotKnots as hk
# initialize everything first
params = os.path.dirname(hk.__file__)
hk.initialize( "DP", os.path.join(params,"parameters_DP09.txt") , os.path.join(params,"multirnafold.conf"), os.path.join(params,"pkenergy.conf") )
print(hk.fold("AACCCCUGCUGAAUAAAGCGGGGAAUAACUAUUCUAC", "DP"))
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file hotknots-2.4.tar.gz.
File metadata
- Download URL: hotknots-2.4.tar.gz
- Upload date:
- Size: 435.3 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.6.0 importlib_metadata/4.8.2 pkginfo/1.8.1 requests/2.21.0 requests-toolbelt/0.9.1 tqdm/4.61.0 CPython/3.8.2
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
f9e8b14dc77c250735117452ea57f09c550d2cd56f5403ef0175a1c75cccc5a3
|
|
| MD5 |
fa9a2ff22caa1ab9c96c5d1b08e8038a
|
|
| BLAKE2b-256 |
66138e7f5a2afeb2fa51c9e8b81a4bbc5d75c0b5e35f403f09ab76e4495c6140
|
File details
Details for the file hotknots-2.4-cp38-cp38-macosx_10_14_x86_64.whl.
File metadata
- Download URL: hotknots-2.4-cp38-cp38-macosx_10_14_x86_64.whl
- Upload date:
- Size: 603.6 kB
- Tags: CPython 3.8, macOS 10.14+ x86-64
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.6.0 importlib_metadata/4.8.2 pkginfo/1.8.1 requests/2.21.0 requests-toolbelt/0.9.1 tqdm/4.61.0 CPython/3.8.2
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
cc55e00447864849c539a3acb1cdba6c34d9cb38f9cf1ea99cbfe8e875de7f5a
|
|
| MD5 |
0f9733732081e64babcb2a6614c44eb8
|
|
| BLAKE2b-256 |
48e31068c7ff2648921adfa12727976509ddb9044e3c73c776f237ed3d93f279
|