Skip to main content

A BloomFilterTrie implementation to be generally applicable for genomic applications.

Project description

kcollections

Build Status

A fast and efficient library for storing k-mers in c++ and python.

About

kcollections is a python-like dict and set that efficiently store kmers as keys or elements of the collection. It is designed for building/prototyping Bioinformatics tools that rely on kmers but where the included dict and set consume too much memory for use.

It implements the Bloom Filter Trie algorithm. This implementation differs from Guillaume et al. by allowing kmers of arbitrary size and by providing a generic dictionary/map data structure for associating arbitrary values with kmers.

kcollections is currently only available for Python version 2.7.

Installation

We provide some pre-compiled binaries for python 2/3 and Linux and MacOS:

pip install kcollections

Alternatively, you can build from source.

Build from source

Prerequisites include:

  • CMake, must be installed manually in order to build the code.
  • boost, at least version 1.65.1
  • uint256_t, included in the repository.
  • pybind11, included in the repository.

To build and install the python module from source:

git clone https://github.com/masakistan/kcollections.git
cd kcollections

# python 3
python3 setup.py install
# or
pip3 install .

# python 2
python2 setup.py install
# or
pip2 install .

Additionally, if you would like to access the functions from a C++ program, you can build static libraries with the following steps:

git clone https://github.com/masakistan/kcollections.git
cd kcollections

mkdir build
cd build

cmake ..
make

Example Usage

Using Kset

Serial Insertion, writing/reading to/from disk

Kmers can be added one at a time with add, but the fastest way to add kmers to a set is to add a DNA sequence using add_seq.

import kcollections
ks = kcollections.Kset(27)

# add single kmer
ks.add('AAACTGTCTTCCTTTATTTGTTCAGGG')

# sequence insertion
seq = 'AAACTGTCTTCCTTTATTTGTTCAGGGATCGTGTCAGTA'
ks.add_seq(seq, len(seq))

assert 'AAACTGTCTTCCTTTATTTGTTCAGGG' in ks
# iteration
for kmer in ks:
    print kmer

ks.write("data.bs")
del ks

# sometime later

ks = Kcollections.Kset()
ks.read("data.bs")

Parallel Insertion

The fastest way to use Kset is to use multithreaded insertion. Multithreaded approach is best used when all kmers are loaded upfront. Kmers not accessible until the threads have been joined using parallel_add_join. See the example below on how parallel and serial insertions can be used.

import kcollections
ks = kcollections.Kset(27)

# multithreaded sequence insertion
# nthreads must be a power of 2.
# nthreads = 4 or 16 work well
ks.parallel_add_init(16)

# insert a sequence of kmers
ks.parallel_add_seq(seq)

# insert a single kmer
ks.parallel_add('AAACTGTCTTCCTTTATTTGTTCACAG')

# merge threads together
# no parallel add methods can be used after joining
ks.parallel_add_join()

# serial add is permissible after threads have joined
ks.add('AAACTGTCTTCCTTTATTTGTTCACAG')

# iteration
for kmer in ks:
    print(kmer)
print len(ks)

Using Kdict

Serial Insertion

import kcollections
kd = kcollections.Kdict(str, 27)

# insertion and value assignment
kd['AAACTGTCTTCCTTTATTTGTTCAGGG'] = 'banana'
kd['AAACTGTCTTCCTTTATTTGTTCAGGT'] = 'phone'
assert kd['AAACTGTCTTCCTTTATTTGTTCAGGG'] == 'banana'
assert kd['AAACTGTCTTCCTTTATTTGTTCAGGT'] == 'phone'

# iteration
for kmer, val in kd.items():
    print(kmer, val)

# removal
del kd['AAACTGTCTTCCTTTATTTGTTCAGGT']

Parallel Insertion

Parallel insertion for Kdict requires the inclusion of a merging function to resolve different values for the same key. The following snippet adds 27mers from a string of DNA using a provided lambda function to merge value conflicts. This merge function simply keeps the newest value associated with the kmer. More examples of merging functions with Kdict can be found here.

kd = kcollections.Kdict(int, 27)
kd.parallel_add_init(4)
kd.set_merge_func(lambda prev_val, new_val: new_val)
kd.parallel_add_seq(dna, generate_idx(len(dna)))
kd.parallel_add_join()

Using Kcounter

Kcounter is an implementation of the Python collection's Counter, but the keys must be kmers, of course! Like Kdict, kmers can be added to Kcounter one at a time, but the fastest ways to add kmers to a set is to add an DNA sequence using add_seq (or parallel_add_seq for multithreaded inserts).

Serial Insertion

from kcollections import Kcounter
kc = Kcounter(27)

# add single kmer
kc['AAACTGTCTTCCTTTATTTGTTCAGGG'] += 1

# sequence insertion
seq = 'AAACTGTCTTCCTTTATTTGTTCAGGGATCGTGTCAGTA'
kc.add_seq(seq)

assert kc['AAACTGTCTTCCTTTATTTGTTCAGGG'] == 2

# iteration
for kmer, count in kc.items():
    print(kmer, count)

Parallel Insertion

from kcollections import Kcounter
kc = Kcounter(27)

# multithreaded sequence insertion
# nthreads must be a power of 2.
# nthreads = 4 or 16 work well
kc.parallel_add_init(16)

# insert a sequence of kmers
kc.parallel_add_seq(seq)

# insert a single kmer
kc.parallel_add('AAACTGTCTTCCTTTATTTGTTCACAG')

# merge threads together
# no parallel add methods can be used after joining
kc.parallel_add_join()

# updates can be made after the join
kc['AAACTGTCTTCCTTTATTTGTTCAGGG'] += 1

# iteration
for kmer, count in kc.items():
    print(kmer, count)

Performance

kcollections is quite a bit slower than the dict or set but is much more memory-efficient. We measured memory usage and running time using /usr/bin/time -v on aIntel(R) Xeon(R) E5-2650v4 @2.20GHz with 256 GB RAM. 27mers used for testing were taken from the human genome, no repetitive kmers appear in our dataset providing a worst case scenario where no insertions or queries are pruned before traversing the entire data structure.

Memory Usage

# kmers kset set
1 million 25.32 MB 105.82 MB
10 million 63.74 MB 906.96 MB
100 million 0.56 GB 11.98 GB
500 million 2.42 GB 48.54 GB
1 billion 4.43 GB 97.07 GB
1.5 billion 6.44 GB 191.61 GB
2 billion 8.44 GB 194.14 GB
2.4 billion 10.08 GB 220.06 GB

Figure of memory usage

Insertion Time

Insertion time comparisons using built-in Python set, kcollections serial and parallel insert.

Figure of insertion time

Read Mapper and Assembler

An example read mapping algorithm and assembler are provided using kcollections in the applications directory.

Citation

Acknowledgements

kcollections was built at the Computational Science Laboratory at Brigham Young University by Stanley Fujimoto (@masakistan) and Cole Lyman (@colelyman).

Funding was provided by the Utah NASA Space Grant Consortium and the BYU Graduate Research Fellowship.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distributions

No source distribution files available for this release.See tutorial on generating distribution archives.

Built Distributions

kcollections-1.0.4-cp37-cp37m-manylinux1_x86_64.whl (1.1 MB view hashes)

Uploaded CPython 3.7m

kcollections-1.0.4-cp37-cp37m-macosx_10_13_x86_64.whl (1.1 MB view hashes)

Uploaded CPython 3.7m macOS 10.13+ x86-64

kcollections-1.0.4-cp36-cp36m-manylinux1_x86_64.whl (1.1 MB view hashes)

Uploaded CPython 3.6m

kcollections-1.0.4-cp36-cp36m-macosx_10_13_x86_64.whl (1.1 MB view hashes)

Uploaded CPython 3.6m macOS 10.13+ x86-64

kcollections-1.0.4-cp35-cp35m-manylinux1_x86_64.whl (1.1 MB view hashes)

Uploaded CPython 3.5m

kcollections-1.0.4-cp35-cp35m-macosx_10_13_x86_64.whl (1.1 MB view hashes)

Uploaded CPython 3.5m macOS 10.13+ x86-64

kcollections-1.0.4-cp34-cp34m-manylinux1_x86_64.whl (1.1 MB view hashes)

Uploaded CPython 3.4m

kcollections-1.0.4-cp34-cp34m-macosx_10_13_x86_64.whl (1.1 MB view hashes)

Uploaded CPython 3.4m macOS 10.13+ x86-64

kcollections-1.0.4-cp27-cp27m-manylinux1_x86_64.whl (1.1 MB view hashes)

Uploaded CPython 2.7m

kcollections-1.0.4-cp27-cp27m-macosx_10_13_x86_64.whl (1.1 MB view hashes)

Uploaded CPython 2.7m macOS 10.13+ x86-64

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page