KmerExploR provides information on RNA-sequencing datasets.
Project description
KmerExploR
Description
From a bunch of fastq or countTags output files, by default, KmerExploR provides information on Human RNA-sequencing datasets :
- wether the analysis is based on poly-A selection protocol or ribo-depletion,
- whether the analysis is based on oriented or non-oriented sequencing,
- gender,
- whether there is a read coverage bias from 5' to 3' long transcripts
- wether the data are contamined by HeLa, mycoplasma is present or not, or other viruses such as hepatitis B virus
- specie
Other type of information can be queried, using -l/--list
then -b/--builtin-tags
.
KmerExploR
uses a set of reference specific kmers designed with Kmerator (https://github.com/Transipedia/kmerator).
For general usage, we will use one of the provided sets of tags. Howerver, it is also possible to create your own tags reference file to have specific informations on you samples such as request on a particular specie.
This code is under GPL3 licence.
Testing with dataset
You can use the following dataset to test the software and to illustrate the different categories, which contains 5 paired-end human RNA-seq samples:
PolyA/RiboD | HeLa | Mycoplasma | Stranded | Sex | fastq1 | fastq2 | |
---|---|---|---|---|---|---|---|
SRR12010285 | PolyA | + | - | yes | female | link | link |
ENCFF322RPT | PolyA | - | + | yes | male | link | link |
ENCFF001RMX | RiboD | - | - | yes | female | link | link |
SRR1957703 | PolyA | - | - | yes | NA | link | link |
SRR1957706 | PolyA | - | - | no | NA | link | link |
Installation
KmerExploR
needs yaml
and markdown
python module,
We recommand tu use ``pip` as it install everything you need automatically.
Option 1: install KmerExploR with pip
pip install kmerexplor
Nota: make sure your PATH variable include ~/.local/bin
.
Option 2: install KmerExploR with git by cloning repository
# clone the repository
git clone https://github.com/Transipedia/kmerexplor.git
# create link somewhere in your PATH
sudo ln -s $PWD/kmerexplor/kmerexplor/core.py /usr/local/bin/kmerexplor
Input
Required:
- fastq or outputs from countTags (gzipped or not).
For paired samples, fastq names must be in illumina format (_R1_001
and _R2_001
), otherwise they must end by _1.fastq[.gz]
and _2.fastq[.gz]
or _R1.fastq[.gz]
and _R2.fastq[.gz]
. countTags
files must end by tsv[.gz]
. countTags
files can be aggregated in a single multi-culumn file.
For advanced usage:
- tags file
- yaml configuration file
- markdown file (facultative)
Both yaml and tags file must match (see below).
Output
By default, outputs are produced in directory kmerexplor-results
.
table.tsv
: tab separated table of results.kmerexplor.html
: graphical results.lib
directory contains css and javascript code associated withkmerexplor.html
.- if
--keep-counts
option is specifiedcountTags
directory contains countTags output.
kmerexplor-results
├── countTags # with '--keep' option
├── kmerTool.html
├── lib
│ ├── echarts-en.min.js
│ ├── scripts.js
│ └── styles.css
└── table.tsv
Usage
Without options or with --help
, KmerExploR
returns Help
usage: kmerexplor [-h] [-s] [-p] [-k <int>] [-K] [-d] [-b BUILTIN_TAGS] [-o <output_dir>] [--tmp-dir <tmp_dir>] [-C <file_name>] [-T <tag_file>] [-l]
[--dump-config file_name] [--show-tags] [--title <string>] [-y] [-c <int>] [-v]
[<file1> ... ...]
positional arguments:
<file1> ... fastq or fastq.gz or tsv countTags output files.
optional arguments:
-h, --help show this help message and exit
-s, --single when samples are single.
-p, --paired when samples are paired.
-k <int>, --kmer-size <int>
kmer size (default 31).
-K, --keep-counts keep countTags outputs.
-d, --debug debug.
-b BUILTIN_TAGS, --builtin-tags BUILTIN_TAGS
Choose a kmer set between ['human-quality'] (default: human-quality)
-o <output_dir>, --output <output_dir>
output directory (default: "./kmerexplor-results").
-l, --list-tagsets List available kmer sets
--tmp-dir <tmp_dir> temporary files directory.
--title <string> title to be displayed in the html page.
-y, --yes, --assume-yes
assume yes to all prompt answers.
-c <int>, --cores <int>
specify the number of files which can be processed simultaneously by countTags. (default: 1). Valid when inputs are fastq files.
-v, --version show program's version number and exit
advanced features:
-C <file_name>, --config <file_name>
alternate config yaml file. Used with '--tags' option
-T <tag_file>, --tags <tag_file>
alternate tag file. Could be fasta or tsv file (gzip or not).
Needs '--config' option
extra features:
--dump-config file_name
dump builtin config file as specified name as yaml format and exit.
--show-tags print builtin categories and predictors and exit.
Options
-k --keep-counts
By default, KmerExploR
deletes intermediate files, particularly countTags output (when input files are fastq files). You could keep countTags output files by using -K/--keep-counts
option. The location of the countTags output files will then be displayed on the standard output.
countTags outputs are located in a directory named countTags
, located in kmerexplor-results
by default or specified by -o
option.
If you want to run again KmerExploR with the same input dataset, you can directly use this directory (kmerexplor-results/countTags/*.tsv
). CountTags step will be bypassed which is saving a lot of time.
-b/--builtin-tags
By default, the human-quality tag set is applied, alternatively, you can choose other.
To help, -l/--list-tagsets
displayed available tag sets.
-T/--tags tags_file (advanced usage)
KmerExploR uses an internal default tag file. You can specify your own tags file using -T/--tags
option with an alternate tags file (compressed or not). It could be formated as tabuled (tsv) or fasta format
how the tag file should be formatted ?
Example using a tsv file :
AACGCCGCGCGTGACAACAAGAAGACCAGGA Histone-H2AFJ-unused
Example using a fasta file
>Histone-H2AFJ-unused
AACGCCGCGCGTGACAACAAGAAGACCAGGA
where:
AACGCCGCGCGTGACAACAAGAAGACCAGGA
: kmerHistone
: categoryH2AFJ
: seq_idunused
: for convenience, but not used by KmerExploR (facultative)
Warning : seq_id
must be enclosed by dashes.
Warning : config.yaml
file must refer to the same categories than tags file, otherwise KmerExploR does not display results (Histone
in the example).
Notice : the description of a set of tags can can be displayed on the main home page by creating a markdown file with the same name, but suffixed with .md
(eg: my-tags.tsv -> my-tags.md).
-C/--config config.yaml
Associated to the tags file, KmerExploR includes a configuration file. It is used to reference kmers by categories (ex: Orientation, Mycoplasma) and display some parameters for graphs. It is strongly linked to the tags file. When you set your own tag file, you also have to specify you own matching config file.
Example for one categorie :
Basic_features: # Meta category, show in left sidenav (underscores are replaced by blank)
Histone: # Must match with first item (characters before first dash) of the second column
# in the tabuled tags file. Also, they will be used for Javascript function names.
# They must be unique, and contain uniquely letters, digits and underscores
sidenav : Poly A / Ribo D
# Show in the left sidebar
title: Poly A and Ribo depletion by Histone detection
# Title of the graph, in the main page.
threshold: 350
# Leave blank if threshold is not needed.
# More than one threshold possible by adding multiple values separated by coma (ex: 350,450).
chart_type: bar
# Only bar is admitted at this time.
chart_theme: light
# light, dark, or nothing
desc: # More details on the graph, located under it
- Short description of Poly A and Ribodepletion (show as title)
- A paragraph of explanations.
- Another paragraph.
Using an alternative tag file, you probably have to redefine the config.yaml
file, --config
option specifies the location of an alternative yaml configuration file.
Nota: if you add as_percent:
to a category (empty or not), results will be in percentage (take a look at Read biases
results).
Some Examples:
Mandatory: -p
for paired-end or -s
for single:
kmerexplor -p path/to/*.fastq.gz
-c
for multithreading, -K
to keep counts (input must be fastq):
kmerexplor -p -c 16 -K path/to/*.fastq.gz
You can skip the counting step thanks to countTags output (see -K
option):
kmerexplor -p path/to/countTags/files/*.tsv
-o
to choose your directory output (directory will be created),
--title
to show title in results:
kmerexplor -p -o output_dir --title 'Title in html page dir/*.fastq.gz'
Use an alternative tagset:
# display available tagsets
kmerexplor --list-tagsets
# run kmerexplor with alternative builtin tagset
kmerexplor -p path/to/*.fastq.gz -b mouse-quality
Advanced: using your own tag file and associated config.yaml file:
kmerexplor -p --tags my_tags.tsv --config my_config.yaml dir/*.fast.gz
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Hashes for kmerexplor-1.1.1-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | dd85bdcc617ad2c605ec1f0906f3c1eb7db102803e48c447b69cf08422c1069e |
|
MD5 | 8a560f6c4729dba74ece8a943c7135d1 |
|
BLAKE2b-256 | c191a4b9765fe863ee65deb3107f35e3e244d07ff105732d1ba5988e429b3681 |