What else in these samples ?
Project description
KmerExploR
Description
From a bunch of fastq or countTags output files, KmerExploR provides informations on the nature of the samples analyzed, such as gender, whether the analysis is based on oriented or non-oriented sequencing, whether mycoplasma is present, and much more.
KmerExploR
uses a set of reference kmers.
We will generally use the existing kmer set. But it is also possible to create your own kmers reference file, for example for a search on a particular species.
This code is under GPL3 licence.
Installation
KmerExploR
needs yaml
python module, pip
automatically install it, not git
.
You may install kmerexplor with pip:
# as user
python3 -m pip install --user kmerexplor
# as root or in virtualenv
python3 -m pip install kmerexplor
Nota: using pip as user without virtual environment, make sure PATH variable include ~/.local/bin
.
or by cloning repository:
# clone the repository
git clone https://github.com/Transipedia/kmerexplor.git
# create link somewhere in your PATH
sudo ln -s $PWD/kmerexplor/kmerexpor/core.py /usr/local/bin/kmerexplor
Input
required:
- fastq or outputs from countTags (gzipped or not).
For paired samples, fastq names must be in illumina format (_R1_001
and _R2_001
), or they must end by _1.fastq[.gz]
and 2.fastq[.gz]
. countTags
files must end by tsv[.gz]
. countTags
files can be aggregate in a multiculumn single file.
optional:
- yaml configuration file.
- tags file.
Both must match (see below).
Output
By default, outputs are produced in directory kmerexplor-results
.
table.tsv
: tab separated table of results.kmerexplor.html
: graphical results.lib
directory contains css and javascript code associated with KmerExploR.html- if
--keep-counts
option is specifiedcountTags
directory contains countTags output.
Examples:
Mandatory: -p
for paired-end or -s
for single:
kmerexplor -p path/to/*.fastq.gz
-c
for multithreading, -k
to keep counts (input must be fastq):
kmerexplor -p -c 16 -k path/to/*.fastq.gz
You can skip the count step thanks to countTags output (see -k
option):
kmerexplor -p path/to/countTags/files/*.tsv
-o
to choose a directory output, --title
to show title in results:
kmerexplor -p -o output_dir --title 'Title in html page dir/*.fastq.gz'
Advanced: use your own tag file and associated config.yaml file:
kmerexplor -p -tags my_tags.tsv --config my_config.yaml dir/*.fast.gz
Usage
Without options or with --help
, KmerExploR
returns Help
usage: kmerexplor [-h] [-d] [-t TAGS] (-s | -p) [-o output_dir] [-k]
[--tmp-dir tmp_dir] [--scale scale] [--config config.yaml]
[--title TITLE] [-y] [-c cores] [-v]
files [files ...]
positional arguments:
files fastq or fastq.gz or tsv countTag files
optional arguments:
-h, --help show this help message and exit
-d, --debug debug
-t TAGS, --tags TAGS tag file
-s, --single when samples are single
-p, --paired when samples are paired
-o output_dir, --output output_dir
output directory (default: "./KmerExploR-results")
-k, --keep-counts keep countTags outputs
--tmp-dir tmp_dir Temporary files directory
--scale scale Scale factor, to avoid too small values of counts.
(default: 1)
--config config.yaml Configuration yaml file of each category (default:
"lib/config.yaml")
--title TITLE Title to be displayed in the html page
-y, --yes, --assume-yes
Assume yes to all prompt answers
-c cores, --cores cores
Number of CPUs cores (default: 1). Valid especially
when starting from fastq file.
-v, --version show program's version number and exit
Options
-k --keep-counts
By default, KmerExploR
deletes intermediate files, particularly countTags output (when input files are fastq files). You could keep countTags output files by using --keep-counts
option. The location of the countTags output files will then be displayed on the standard output.
countTags outputs are located in a directory named countTags
, located in kmerexplor-results
by default or specified by -o
option.
Then when you run KmerExploR with this directory as argument (kmerexplor-results/countTags/*.tsv
by default), countTags
step is bypassed, saving a lot of time.
--tags tags_file
KmerExploR uses an internal default tag file. You can specify another tags file with --tags
option with as alternate tags file (compressed or not).
Tags file format
Tags file format is tabuled in 2 columns.
- column 1 : kmer
- column 2 : description, dashes "-" are important, because they define a structure.
Example :
AACGCCGCGCGTGACAACAAGAAGACCAGGA Histone-H2AFJ-ENST00000501744.2.fa.kmer58
AACGCCGCGCGTGACAACAAGAAGACCAGGA
: kmerHistone
: categoryH2AFJ
: seq_idENST00000501744.2.fa.kmer58
: seq_def (not used)
Warning : config.yaml
file must refer to the same categories than tags file, otherwise KmerExploR does not display results (Histone
in the example).
--config config.yaml
Associated to the tags file, KmerExploR include a configuration file. It is used to reference kmers by categories (ex: Orientation, Mycoplasma) and display some parameters for graphs. It is strongly linked to the tags file. When you set your own tag file, probably you will must specify you own config file.
Example for a categorie :
Basic_features: # Meta category, show in left sidenav (underscores are replaced by blank)
Histone: # Must match with first item (characters before first dash) of the second column
# in the tabuled tags file. Also, they will be used for Javascript function names.
# They must be uniq, and contain uniquely letters, digits and underscores
sidenav : Poly A / Ribo D
# Show in the left sidebar
title: Poly A and Ribo depletion by Histone detection
# Title of the graph, in the main page.
threshold: 350
# nothing if threshold is not needed.
# More than one threshold possible by adding multiple values separated by coma (ex: 350,450).
chart_type: bar
# Only bar at this time.
chart_theme: light
# light, dark, or nothing
desc: # More details on the graph, located under it
- Short description of Poly A and Ribodepletionq
- A paragraph of explanations.
- Another paragraph.
Using an alternative tag file, you probably have to redefine the config.yaml
file, --config
option specifies the location of an alternative yaml configuration file.
Nota: if you add as_percent:
to a category, results will be in percentage (take a look at Read biases
results).
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Hashes for kmerexplor-0.4.2-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | 0fb7cae716867e5fd194d09ea3db596ad45d5be2248619d0669b3a10f5dee23c |
|
MD5 | 1908b131a84b45405c403ac1e8c08765 |
|
BLAKE2b-256 | ddb7d7b461be749e38632a0f94253aeafe9c3737d77600fdcb15929e91e57ec7 |