KmerExploR provides information on RNA-sequencing datasets.
Project description
KmerExploR
Description
From a bunch of fastq or countTags output files, KmerExploR provides information on RNA-sequencing datasets :
- wether the analysis is based on poly-A selection protocol or ribo-depletion,
- whether the analysis is based on oriented or non-oriented sequencing,
- gender,
- whether there is a read coverage bias from 5' to 3' long transcripts
- wether the data are contamined by HeLa, mycoplasma is present or not, or other viruses such as hepatitis B virus
- specie
KmerExploR
uses a set of reference specific kmers designed with Kmerator (https://github.com/Transipedia/kmerator).
For general usage, we will use the provided set of kmers. Howerver, it is also possible to create your own kmers reference file to have specific informations on you samples such as request on a particular specie.
This code is under GPL3 licence.
Testing with dataset
You can use the following dataset to test the software and to illustrate the different categories, which contains 5 paired-end human RNA-seq samples:
PolyA/RiboD | HeLa | Mycoplasma | Stranded | Sex | fastq1 | fastq2 | |
---|---|---|---|---|---|---|---|
SRR12010285 | PolyA | + | - | yes | female | link | link |
ENCFF322RPT | PolyA | - | + | yes | male | link | link |
ENCFF001RMX | RiboD | - | - | yes | female | link | link |
SRR1957703 | PolyA | - | - | yes | NA | link | link |
SRR1957706 | PolyA | - | - | no | NA | link | link |
Installation
KmerExploR
needs yaml
python module,
We recommand tu use ``pip` as it install everything you need automatically.
Option 1: install KmerExploR with pip
# as user
python3 -m pip install --user kmerexplor
# in virtualenv or as root
python3 -m pip install kmerexplor
Nota: using pip as user without virtual environment, make sure your PATH variable include ~/.local/bin
.
Option 2: install KmerExploR with git by cloning repository
# clone the repository
git clone https://github.com/Transipedia/kmerexplor.git
# create link somewhere in your PATH
sudo ln -s $PWD/kmerexplor/kmerexplor/core.py /usr/local/bin/kmerexplor
Input
required:
- fastq or outputs from countTags (gzipped or not).
For paired samples, fastq names must be in illumina format (_R1_001
and _R2_001
), or they must end by _1.fastq[.gz]
and 2.fastq[.gz]
. countTags
files must end by tsv[.gz]
. countTags
files can be aggregated in a single multi-culumn file.
optional:
- yaml configuration file.
- tags file.
Both must match (see below).
Output
By default, outputs are produced in directory kmerexplor-results
.
table.tsv
: tab separated table of results.kmerexplor.html
: graphical results.lib
directory contains css and javascript code associated withkmerexplor.html
.- if
--keep-counts
option is specifiedcountTags
directory contains countTags output.
kmerexplor-results
├── countTags # with '--keep' option
├── kmerTool.html
├── lib
│ ├── echarts-en.min.js
│ ├── scripts.js
│ └── styles.css
└── table.tsv
Usage
Without options or with --help
, KmerExploR
returns Help
usage: kmerexplor [-h] (-s | -p) [-k <int>] [-K] [-d] [-o <output_dir>]
[--tmp-dir <tmp_dir>] [--config <file_name>] [-t <tag_file>]
[--dump-config [file_name]] [--show-tags]
[--title <string>] [-y] [-c <int>] [-v]
<file1> ... [<file1> ... ...]
positional arguments:
<file1> ... fastq or fastq.gz or tsv countTags output files.
optional arguments:
-h, --help show this help message and exit
-s, --single when samples are single.
-p, --paired when samples are paired.
-k <int>, --kmer-size <int>
kmer size (default 31).
-K, --keep-counts keep countTags outputs.
-d, --debug debug.
-o <output_dir>, --output <output_dir>
output directory (default: "./kmerexplor-results").
--tmp-dir <tmp_dir> temporary files directory.
--title <string> title to be displayed in the html page.
-y, --yes, --assume-yes
assume yes to all prompt answers.
-c <int>, --cores <int>
specify the number of files which can be processed
simultaneously by countTags. (default: 1). Valid when
inputs are fastq files.
-v, --version show program's version number and exit
advanced features:
--config <file_name> alternate config yaml file.
-t <tag_file>, --tags <tag_file>
alternate tag file.
extra features:
--dump-config [file_name]
dump builtin config file as specified name to current
directory and exit (default name: config.yaml).
--show-tags print builtin categories and predictors and exit.
Options
-k --keep-counts
By default, KmerExploR
deletes intermediate files, particularly countTags output (when input files are fastq files). You could keep countTags output files by using --keep-counts
option. The location of the countTags output files will then be displayed on the standard output.
countTags outputs are located in a directory named countTags
, located in kmerexplor-results
by default or specified by -o
option.
If you want to run again KmerExploR with the same input dataset, you can directly use this directory (kmerexplor-results/countTags/*.tsv
). CountTags step will be bypassed which is saving a lot of time.
--tags tags_file
KmerExploR uses an internal default tag file. You can specify another tags file using --tags
option with an alternate tags file (compressed or not).
Tags file format
Tags file format is tabuled in 2 columns.
- column 1 : kmer sequence
- column 2 : description with dashes "-" are separator, The dashes are very important to define the structure.
Example :
AACGCCGCGCGTGACAACAAGAAGACCAGGA Histone-H2AFJ-ENST00000501744.2.fa.kmer58
AACGCCGCGCGTGACAACAAGAAGACCAGGA
: kmerHistone
: categoryH2AFJ
: seq_idENST00000501744.2.fa.kmer58
: seq_def (not used)
Warning : config.yaml
file must refer to the same categories than tags file, otherwise KmerExploR does not display results (Histone
in the example).
Notice : the description of a set of tags can can be displayed on the main home page by creating a markdown file of the same name, suffixed with .md
(eg: my-tags.tsv -> my-tags.md).
--config config.yaml
Associated to the tags file, KmerExploR includes a configuration file. It is used to reference kmers by categories (ex: Orientation, Mycoplasma) and display some parameters for graphs. It is strongly linked to the tags file. When you set your own tag file, you also have to specify you own matching config file.
Example for one categorie :
Basic_features: # Meta category, show in left sidenav (underscores are replaced by blank)
Histone: # Must match with first item (characters before first dash) of the second column
# in the tabuled tags file. Also, they will be used for Javascript function names.
# They must be unique, and contain uniquely letters, digits and underscores
sidenav : Poly A / Ribo D
# Show in the left sidebar
title: Poly A and Ribo depletion by Histone detection
# Title of the graph, in the main page.
threshold: 350
# Leave blank if threshold is not needed.
# More than one threshold possible by adding multiple values separated by coma (ex: 350,450).
chart_type: bar
# Only bar is admitted at this time.
chart_theme: light
# light, dark, or nothing
desc: # More details on the graph, located under it
- Short description of Poly A and Ribodepletion (show as title)
- A paragraph of explanations.
- Another paragraph.
Using an alternative tag file, you probably have to redefine the config.yaml
file, --config
option specifies the location of an alternative yaml configuration file.
Nota: if you add as_percent:
to a category (empty or not), results will be in percentage (take a look at Read biases
results).
Examples:
Mandatory: -p
for paired-end or -s
for single:
kmerexplor -p path/to/*.fastq.gz
-c
for multithreading, -K
to keep counts (input must be fastq):
kmerexplor -p -c 16 -K path/to/*.fastq.gz
You can skip the counting step thanks to countTags output (see -K
option):
kmerexplor -p path/to/countTags/files/*.tsv
-o
to choose your directory output (directory will be created),
--title
to show title in results:
kmerexplor -p -o output_dir --title 'Title in html page dir/*.fastq.gz'
Advanced: using your own tag file and associated config.yaml file:
kmerexplor -p -tags my_tags.tsv --config my_config.yaml dir/*.fast.gz
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Hashes for kmerexplor-0.7.1-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | a715773f977f3575c7aaafb10a5ca40b0003a3f9f0d48eb45965c06f98bf88b4 |
|
MD5 | 0c14a7f5ed43fdf9f09d2c388fb68cd0 |
|
BLAKE2b-256 | 3888458054b6dc85b06c3368feb21696d8595db6aebfe66c661b7c0453f1fc1c |