Minimap2 python binding
Project description
Minimap2 is a fast and accurate pairwise aligner for genomic and transcribed nucleotide sequences. This Python extension provides a convenient interface to calling minimap2 in Python.
Installation
The mappy module can be installed directly with:
git clone https://github.com/lh3/minimap2
cd minimap2
python setup.py install
or with pip:
pip install --user mappy
Usage
The following Python program shows the key functionality of this module:
import mappy as mp
a = mp.Aligner("test/MT-human.fa") # load or build index
if not a: raise Exception("ERROR: failed to load/build index")
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
It builds an index from the specified sequence file (or loads an index if a pre-built index is specified), aligns a sequence against it, traverses each hit and prints them out.
APIs
Class mappy.Aligner
Aligner(fn_idx_in, preset=None, ...)
Arguments:
fn_idx_in: index or sequence file name. Minimap2 automatically tests the file type. If a sequence file is provided, minimap2 builds an index. The sequence file can be optionally gzip’d.
preset: minimap2 preset. Currently, minimap2 supports the following presets: sr for single-end short reads; map-pb for PacBio read-to-reference mapping; map-ont for Oxford Nanopore read mapping; splice for long-read spliced alignment; asm5 for assembly-to-assembly alignment; asm10 for full genome alignment of closely related species. Note that the Python module does not support all-vs-all read overlapping.
k: k-mer length, no larger than 28
w: minimizer window size, no larger than 255
min_cnt: mininum number of minimizers on a chain
min_chain_score: minimum chaing score
bw: chaining and alignment band width
best_n: max number of alignments to return
n_threads: number of indexing threads; 3 by default
fn_idx_out: name of file to which the index is written
map(seq)
This method maps seq
against the index. It yields a generator,
generating a series of Alignment
objects.
Class mappy.Alignment
This class has the following properties:
ctg: name of the reference sequence the query is mapped to
ctg_len: total length of the reference sequence
r_st and r_en: start and end positions on the reference
q_st and q_en: start and end positions on the query
strand: +1 if on the forward strand; -1 if on the reverse strand
mapq: mapping quality
NM: number of mismatches and gaps in the alignment
blen: length of the alignment, including both alignment matches and gaps
trans_strand: transcript strand. +1 if on the forward strand; -1 if on the reverse strand; 0 if unknown
is_primary: if the alignment is primary (typically the best and the first to generate)
cigar_str: CIGAR string
cigar: CIGAR returned as an array of shape
(n_cigar,2)
. The two numbers give the length and the operator of each CIGAR operation.
An Alignment
object can be converted to a string in the following format:
q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.