Skip to main content

Markov chains and Hidden Markov models

Project description

https://img.shields.io/circleci/build/github/maximtrp/mchmm Documentation Status https://img.shields.io/github/issues/maximtrp/mchmm.svg https://codecov.io/gh/maximtrp/mchmm/branch/master/graph/badge.svg https://app.codacy.com/project/badge/Grade/d7881a827eb9473d89aa1fc10fdd855e https://pepy.tech/badge/mchmm https://img.shields.io/pypi/v/mchmm.svg

mchmm is a Python package implementing Markov chains and Hidden Markov models in pure NumPy and SciPy. It can also visualize Markov chains (see below).

Dependencies

Installation

  1. Install from PyPi:

$ pip install mchmm
  1. Clone a GitHub repository:

$ git clone https://github.com/maximtrp/mchmm.git
$ cd mchmm
$ pip install . --user

Features

Discrete Markov chains

Initializing a Markov chain using some data.

>>> import mchmm as mc
>>> a = mc.MarkovChain().from_data('AABCABCBAAAACBCBACBABCABCBACBACBABABCBACBBCBBCBCBCBACBABABCBCBAAACABABCBBCBCBCBCBCBAABCBBCBCBCCCBABCBCBBABCBABCABCCABABCBABC')

Now, we can look at the observed transition frequency matrix:

>>> a.observed_matrix
array([[ 7., 18.,  7.],
       [19.,  5., 29.],
       [ 5., 30.,  3.]])

And the observed transition probability matrix:

>>> a.observed_p_matrix
array([[0.21875   , 0.5625    , 0.21875   ],
       [0.35849057, 0.09433962, 0.54716981],
       [0.13157895, 0.78947368, 0.07894737]])

You can visualize your Markov chain. First, build a directed graph with graph_make() method of MarkovChain object. Then render() it.

>>> graph = a.graph_make(
      format="png",
      graph_attr=[("rankdir", "LR")],
      node_attr=[("fontname", "Roboto bold"), ("fontsize", "20")],
      edge_attr=[("fontname", "Iosevka"), ("fontsize", "12")]
    )
>>> graph.render()

Here is the result:

images/mc.png

Pandas can help us annotate columns and rows:

>>> import pandas as pd
>>> pd.DataFrame(a.observed_matrix, index=a.states, columns=a.states, dtype=int)
    A   B   C
A   7  18   7
B  19   5  29
C   5  30   3

Viewing the expected transition frequency matrix:

>>> a.expected_matrix
array([[ 8.06504065, 13.78861789, 10.14634146],
       [13.35772358, 22.83739837, 16.80487805],
       [ 9.57723577, 16.37398374, 12.04878049]])

Calculating Nth order transition probability matrix:

>>> a.n_order_matrix(a.observed_p_matrix, order=2)
array([[0.2782854 , 0.34881028, 0.37290432],
       [0.1842357 , 0.64252707, 0.17323722],
       [0.32218957, 0.21081868, 0.46699175]])

Carrying out a chi-squared test:

>>> a.chisquare(a.observed_matrix, a.expected_matrix, axis=None)
Power_divergenceResult(statistic=47.89038802624337, pvalue=1.0367838347591701e-07)

Finally, let’s simulate a Markov chain given our data.

>>> ids, states = a.simulate(10, start='A', seed=np.random.randint(0, 10, 10))
>>> ids
array([0, 2, 1, 0, 2, 1, 0, 2, 1, 0])
>>> states
array(['A', 'C', 'B', 'A', 'C', 'B', 'A', 'C', 'B', 'A'], dtype='<U1')
>>> "".join(states)
'ACBACBACBA'

Hidden Markov models

We will use a fragment of DNA sequence with TATA box as an example. Initializing a hidden Markov model with sequences of observations and states:

>>> import mchmm as mc
>>> obs_seq = 'AGACTGCATATATAAGGGGCAGGCTG'
>>> sts_seq = '00000000111111100000000000'
>>> a = mc.HiddenMarkovModel().from_seq(obs_seq, sts_seq)

Unique states and observations are automatically inferred:

>>> a.states
['0' '1']
>>> a.observations
['A' 'C' 'G' 'T']

The transition probability matrix for all states can be accessed using tp attribute:

>>> a.tp
[[0.94444444 0.05555556]
 [0.14285714 0.85714286]]

There is also ep attribute for the emission probability matrix for all states and observations.

>>> a.ep
[[0.21052632 0.21052632 0.47368421 0.10526316]
 [0.57142857 0.         0.         0.42857143]]

Converting the emission matrix to Pandas DataFrame:

>>> import pandas as pd
>>> pd.DataFrame(a.ep, index=a.states, columns=a.observations)
          A         C         G         T
0  0.210526  0.210526  0.473684  0.105263
1  0.571429  0.000000  0.000000  0.428571

Directed graph of the hidden Markov model:

images/hmm.png

Graph can be visualized using graph_make method of HiddenMarkovModel object:

>>> graph = a.graph_make(
      format="png",
      graph_attr=[("rankdir", "LR"), ("ranksep", "1"), ("rank", "same")]
    )
>>> graph.render()

Viterbi algorithm

Running Viterbi algorithm on new observations.

>>> new_obs = "GGCATTGGGCTATAAGAGGAGCTTG"
>>> vs, vsi = a.viterbi(new_obs)
>>> # states sequence
>>> print("VI", "".join(vs))
>>> # observations
>>> print("NO", new_obs)
VI 0000000001111100000000000
NO GGCATTGGGCTATAAGAGGAGCTTG

Baum-Welch algorithm

Using Baum-Welch algorithm to infer the parameters of a Hidden Markov model:

>>> obs_seq = 'AGACTGCATATATAAGGGGCAGGCTG'
>>> a = hmm.HiddenMarkovModel().from_baum_welch(obs_seq, states=['0', '1'])
>>> # training log: KL divergence values for all iterations
>>> a.log
{
  'tp': [0.008646969455670256, 0.0012397829805491124, 0.0003950986109761759],
  'ep': [0.09078874423746826, 0.0022734816599056084, 0.0010118204023946836],
  'pi': [0.009030829793043593, 0.016658391248503462, 0.0038894983546756065]
}

The inferred transition (tp), emission (ep) probability matrices and initial state distribution (pi) can be accessed as shown:

>>> a.ep, a.tp, a.pi

This model can be decoded using Viterbi algorithm:

>>> new_obs = "GGCATTGGGCTATAAGAGGAGCTTG"
>>> vs, vsi = a.viterbi(new_obs)
>>> print("VI", "".join(vs))
>>> print("NO", new_obs)
VI 0011100001111100000001100
NO GGCATTGGGCTATAAGAGGAGCTTG

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

mchmm-0.4.3.tar.gz (25.4 kB view hashes)

Uploaded source

Built Distribution

mchmm-0.4.3-py3-none-any.whl (23.8 kB view hashes)

Uploaded py3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page