MMseqs2 bindings for Python

This project provides bidings for mmseqs. It's still work in progress. This is the base usage scenario:

import mmseqs

#
# Demonstration of basic mmseqs2 operations
#

# Create a client
client = mmseqs.MMSeqs()

# Create a database from fasta file
# Here we specify name of the database, description and input file
# (The input can also be a Seq/SeqRecord list/iterator/etc.)
client.databases.create("test", "Test database", "example/a.fasta")

# Get description of the database
print(client.databases[0].description)

# Perform search on a database
# Note that the search queries can be a string with a patch to the FASTA file with queries
results = client.databases[0].search(
    [
        "ACTAGCTCAGTCAACTAGCTCAGTCCTCAGTCAACTAGCTCAGTCTATATATATACAAC",
        "ACTAGCTCAGTCAACTAGCTCAGTCCTCAGTCAACTAGCT",
        "ACTAGCTCAGTCAACTAGCT",
        "ACTAGCTCAGT",
    ],
    search_type="nucleotides",
)

# Load queries from file:
# results = client.databases[0].search_file("input.fasta", search_type="nucleotides")

# You can pass list of headers to get:
#   query_sequence_id
#   target_sequence_id
#   query_sequence_content
#   target_sequence_content
#   sequence_identity
#   alignment_length
#   number_of_mismatches
#   number_of_gap_openings
#   domain_start_index_query
#   domain_end_index_query
#   domain_start_index_target
#   domain_end_index_target
#   e_value
#   bit_score
# For example:
# results2 = client.databases[0].search(
#     [
#         "ACTAGCTCAGTCAACTAGCTCAGTCCTCAGTCAACTAGCTCAGTCTATATATATACAAC",
#         "ACTAGCTCAGTCAACTAGCTCAGTCCTCAGTCAACTAGCT",
#         "ACTAGCTCAGTCAACTAGCT",
#         "ACTAGCTCAGT",
#     ],
#     search_type="nucleotides",
#     headers=["query_sequence_id", "target_sequence_id", "sequence_identity", "alignment_length", "number_of_mismatches"]
# )

# results.records is a list of lists. Each item contains alignments for each query.
# Each list of alignments consists of single result
# print(results.records)

# You can also get a pandas dataframe
print(results.dataframe)

Key dates

PyPI data
Data sourced directly from PyPI's database.
  • Released:
Latest release

1 maintainer

PyPI data
Data sourced directly from PyPI's database.
Avatar for styczynski from gravatar.com styczynski

Credits

Author: Piotr Styczyński

Requires

Python >=3.8, <4.0

Classifiers

Report project as malware

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

mmseqs-1.0.0.tar.gz (4.3 MB view details)

Uploaded Source

Built Distributions

If you're not sure about the file name format, learn more about wheel file names.

mmseqs-1.0.0-cp39-cp39-manylinux_2_12_x86_64.manylinux2010_x86_64.whl (36.8 MB view details)

Uploaded CPython 3.9manylinux: glibc 2.12+ x86-64

mmseqs-1.0.0-cp39-cp39-manylinux_2_12_i686.manylinux2010_i686.whl (35.8 MB view details)

Uploaded CPython 3.9manylinux: glibc 2.12+ i686

mmseqs-1.0.0-cp39-cp39-macosx_10_15_x86_64.whl (11.0 MB view details)

Uploaded CPython 3.9macOS 10.15+ x86-64

mmseqs-1.0.0-cp38-cp38-manylinux_2_12_x86_64.manylinux2010_x86_64.whl (36.8 MB view details)

Uploaded CPython 3.8manylinux: glibc 2.12+ x86-64

mmseqs-1.0.0-cp38-cp38-manylinux2014_x86_64.whl (33.7 MB view details)

Uploaded CPython 3.8

mmseqs-1.0.0-cp38-cp38-manylinux2010_i686.manylinux_2_12_i686.whl (35.8 MB view details)

Uploaded CPython 3.8manylinux: glibc 2.12+ i686

mmseqs-1.0.0-cp38-cp38-macosx_10_15_x86_64.whl (11.0 MB view details)

Uploaded CPython 3.8macOS 10.15+ x86-64

File details

Details for the file mmseqs-1.0.0.tar.gz.

File metadata

  • Download URL: mmseqs-1.0.0.tar.gz
  • Upload date:
  • Size: 4.3 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7

File hashes

Hashes for mmseqs-1.0.0.tar.gz
Algorithm Hash digest
SHA256 cb35aeedf0f108e57d1252457e286b18ebb90b6905697bc74c9dd7f7b9ff264a
MD5 8158f10087049993a6f3524c2c7c3338
BLAKE2b-256 cd74d9984792cfbdcfa79bc934015d1ed478b86c02c82a1b8f357cebea2f14d4

See more details on using hashes here.

File details

Details for the file mmseqs-1.0.0-cp39-cp39-manylinux_2_12_x86_64.manylinux2010_x86_64.whl.

File metadata

File hashes

Hashes for mmseqs-1.0.0-cp39-cp39-manylinux_2_12_x86_64.manylinux2010_x86_64.whl
Algorithm Hash digest
SHA256 5d50b465fc65ddb28814f821a944d82fdd8f02d81dc9daf62a7db01b28ece2b7
MD5 d087e2f188a729a00a862ed568b319de
BLAKE2b-256 47ac2239ef7f0dc4d97a1648efebc1a245eb26401f02696101d29ce8ad0f3f4f

See more details on using hashes here.

File details

Details for the file mmseqs-1.0.0-cp39-cp39-manylinux_2_12_i686.manylinux2010_i686.whl.

File metadata

  • Download URL: mmseqs-1.0.0-cp39-cp39-manylinux_2_12_i686.manylinux2010_i686.whl
  • Upload date:
  • Size: 35.8 MB
  • Tags: CPython 3.9, manylinux: glibc 2.12+ i686
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7

File hashes

Hashes for mmseqs-1.0.0-cp39-cp39-manylinux_2_12_i686.manylinux2010_i686.whl
Algorithm Hash digest
SHA256 69ba8f0ee0bf29ce9754c819a00f214abad91ba8bbd959b673a7ebaa091cb352
MD5 5e0d0dc5e0065057d35926a9840454ed
BLAKE2b-256 4dbbd8a1a7952a0b3bd364d9281c4982faacf3acbb851d067097d25074fcc8fe

See more details on using hashes here.

File details

Details for the file mmseqs-1.0.0-cp39-cp39-macosx_10_15_x86_64.whl.

File metadata

  • Download URL: mmseqs-1.0.0-cp39-cp39-macosx_10_15_x86_64.whl
  • Upload date:
  • Size: 11.0 MB
  • Tags: CPython 3.9, macOS 10.15+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7

File hashes

Hashes for mmseqs-1.0.0-cp39-cp39-macosx_10_15_x86_64.whl
Algorithm Hash digest
SHA256 2ae329ce8d79193afa817836686cff4d5e1e866855858672d945a8339e47c6a4
MD5 6458728f71d534b9115082038452d116
BLAKE2b-256 34882f175d258209dc5303f2ec74b8ea59b761653fe8829dd0fdf7c1db51c7fe

See more details on using hashes here.

File details

Details for the file mmseqs-1.0.0-cp38-cp38-manylinux_2_12_x86_64.manylinux2010_x86_64.whl.

File metadata

File hashes

Hashes for mmseqs-1.0.0-cp38-cp38-manylinux_2_12_x86_64.manylinux2010_x86_64.whl
Algorithm Hash digest
SHA256 c65f48346ab7bcf42e706f7606988d690b8d17cdfe003419cd3143d499bab10b
MD5 23d1e706910fcfec2b4cc5cdd4d195e8
BLAKE2b-256 ea2cc142edaa5673c99c2c1eace27911b4a4a674a55e2a01d65fdf170e0e401d

See more details on using hashes here.

File details

Details for the file mmseqs-1.0.0-cp38-cp38-manylinux2014_x86_64.whl.

File metadata

  • Download URL: mmseqs-1.0.0-cp38-cp38-manylinux2014_x86_64.whl
  • Upload date:
  • Size: 33.7 MB
  • Tags: CPython 3.8
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7

File hashes

Hashes for mmseqs-1.0.0-cp38-cp38-manylinux2014_x86_64.whl
Algorithm Hash digest
SHA256 fa7225a96840f0ee67562a1db74ec9229890270b11e565d74f6eb01d30016aed
MD5 a59720af9a739440b6a933879ac7637e
BLAKE2b-256 5f01b1faa4f8c99bb3009de9566c5a265488c60c2f2c49a1758eebf366712601

See more details on using hashes here.

File details

Details for the file mmseqs-1.0.0-cp38-cp38-manylinux2010_i686.manylinux_2_12_i686.whl.

File metadata

  • Download URL: mmseqs-1.0.0-cp38-cp38-manylinux2010_i686.manylinux_2_12_i686.whl
  • Upload date:
  • Size: 35.8 MB
  • Tags: CPython 3.8, manylinux: glibc 2.12+ i686
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7

File hashes

Hashes for mmseqs-1.0.0-cp38-cp38-manylinux2010_i686.manylinux_2_12_i686.whl
Algorithm Hash digest
SHA256 7126af5e0e2612c3a2878ae11730406e661a9f276bf59defe6ab6142bc37a681
MD5 f34a1795f6ad8632299cd039e99fbb1d
BLAKE2b-256 bd90905ac58e7b2db8e6a9329f6f973a3d04e741e105aca88fe55aa8329db371

See more details on using hashes here.

File details

Details for the file mmseqs-1.0.0-cp38-cp38-macosx_10_15_x86_64.whl.

File metadata

  • Download URL: mmseqs-1.0.0-cp38-cp38-macosx_10_15_x86_64.whl
  • Upload date:
  • Size: 11.0 MB
  • Tags: CPython 3.8, macOS 10.15+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7

File hashes

Hashes for mmseqs-1.0.0-cp38-cp38-macosx_10_15_x86_64.whl
Algorithm Hash digest
SHA256 94f21e665863aff59be8db50be7c56cb31b3c457736a0a287ce062734438a1cb
MD5 5b25d7ef56ce14acc0c4b5827dccd170
BLAKE2b-256 1cc2fb4f8031f9deb000e38ed97a1d1782cc0ba36ec3f93a9cf431a9160c1e20

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

1.0.0 This release

8 files

0.1.3

8 files

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page