MMseqs2 bindings for Python
This project provides bidings for mmseqs. It's still work in progress. This is the base usage scenario:
import mmseqs
#
# Demonstration of basic mmseqs2 operations
#
# Create a client
client = mmseqs.MMSeqs()
# Create a database from fasta file
# Here we specify name of the database, description and input file
# (The input can also be a Seq/SeqRecord list/iterator/etc.)
client.databases.create("test", "Test database", "example/a.fasta")
# Get description of the database
print(client.databases[0].description)
# Perform search on a database
# Note that the search queries can be a string with a patch to the FASTA file with queries
results = client.databases[0].search(
[
"ACTAGCTCAGTCAACTAGCTCAGTCCTCAGTCAACTAGCTCAGTCTATATATATACAAC",
"ACTAGCTCAGTCAACTAGCTCAGTCCTCAGTCAACTAGCT",
"ACTAGCTCAGTCAACTAGCT",
"ACTAGCTCAGT",
],
search_type="nucleotides",
)
# Load queries from file:
# results = client.databases[0].search_file("input.fasta", search_type="nucleotides")
# You can pass list of headers to get:
# query_sequence_id
# target_sequence_id
# query_sequence_content
# target_sequence_content
# sequence_identity
# alignment_length
# number_of_mismatches
# number_of_gap_openings
# domain_start_index_query
# domain_end_index_query
# domain_start_index_target
# domain_end_index_target
# e_value
# bit_score
# For example:
# results2 = client.databases[0].search(
# [
# "ACTAGCTCAGTCAACTAGCTCAGTCCTCAGTCAACTAGCTCAGTCTATATATATACAAC",
# "ACTAGCTCAGTCAACTAGCTCAGTCCTCAGTCAACTAGCT",
# "ACTAGCTCAGTCAACTAGCT",
# "ACTAGCTCAGT",
# ],
# search_type="nucleotides",
# headers=["query_sequence_id", "target_sequence_id", "sequence_identity", "alignment_length", "number_of_mismatches"]
# )
# results.records is a list of lists. Each item contains alignments for each query.
# Each list of alignments consists of single result
# print(results.records)
# You can also get a pandas dataframe
print(results.dataframe)
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distributions
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file mmseqs-1.0.0.tar.gz.
File metadata
- Download URL: mmseqs-1.0.0.tar.gz
- Upload date:
- Size: 4.3 MB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
cb35aeedf0f108e57d1252457e286b18ebb90b6905697bc74c9dd7f7b9ff264a
|
|
| MD5 |
8158f10087049993a6f3524c2c7c3338
|
|
| BLAKE2b-256 |
cd74d9984792cfbdcfa79bc934015d1ed478b86c02c82a1b8f357cebea2f14d4
|
File details
Details for the file mmseqs-1.0.0-cp39-cp39-manylinux_2_12_x86_64.manylinux2010_x86_64.whl.
File metadata
- Download URL: mmseqs-1.0.0-cp39-cp39-manylinux_2_12_x86_64.manylinux2010_x86_64.whl
- Upload date:
- Size: 36.8 MB
- Tags: CPython 3.9, manylinux: glibc 2.12+ x86-64
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
5d50b465fc65ddb28814f821a944d82fdd8f02d81dc9daf62a7db01b28ece2b7
|
|
| MD5 |
d087e2f188a729a00a862ed568b319de
|
|
| BLAKE2b-256 |
47ac2239ef7f0dc4d97a1648efebc1a245eb26401f02696101d29ce8ad0f3f4f
|
File details
Details for the file mmseqs-1.0.0-cp39-cp39-manylinux_2_12_i686.manylinux2010_i686.whl.
File metadata
- Download URL: mmseqs-1.0.0-cp39-cp39-manylinux_2_12_i686.manylinux2010_i686.whl
- Upload date:
- Size: 35.8 MB
- Tags: CPython 3.9, manylinux: glibc 2.12+ i686
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
69ba8f0ee0bf29ce9754c819a00f214abad91ba8bbd959b673a7ebaa091cb352
|
|
| MD5 |
5e0d0dc5e0065057d35926a9840454ed
|
|
| BLAKE2b-256 |
4dbbd8a1a7952a0b3bd364d9281c4982faacf3acbb851d067097d25074fcc8fe
|
File details
Details for the file mmseqs-1.0.0-cp39-cp39-macosx_10_15_x86_64.whl.
File metadata
- Download URL: mmseqs-1.0.0-cp39-cp39-macosx_10_15_x86_64.whl
- Upload date:
- Size: 11.0 MB
- Tags: CPython 3.9, macOS 10.15+ x86-64
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
2ae329ce8d79193afa817836686cff4d5e1e866855858672d945a8339e47c6a4
|
|
| MD5 |
6458728f71d534b9115082038452d116
|
|
| BLAKE2b-256 |
34882f175d258209dc5303f2ec74b8ea59b761653fe8829dd0fdf7c1db51c7fe
|
File details
Details for the file mmseqs-1.0.0-cp38-cp38-manylinux_2_12_x86_64.manylinux2010_x86_64.whl.
File metadata
- Download URL: mmseqs-1.0.0-cp38-cp38-manylinux_2_12_x86_64.manylinux2010_x86_64.whl
- Upload date:
- Size: 36.8 MB
- Tags: CPython 3.8, manylinux: glibc 2.12+ x86-64
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
c65f48346ab7bcf42e706f7606988d690b8d17cdfe003419cd3143d499bab10b
|
|
| MD5 |
23d1e706910fcfec2b4cc5cdd4d195e8
|
|
| BLAKE2b-256 |
ea2cc142edaa5673c99c2c1eace27911b4a4a674a55e2a01d65fdf170e0e401d
|
File details
Details for the file mmseqs-1.0.0-cp38-cp38-manylinux2014_x86_64.whl.
File metadata
- Download URL: mmseqs-1.0.0-cp38-cp38-manylinux2014_x86_64.whl
- Upload date:
- Size: 33.7 MB
- Tags: CPython 3.8
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
fa7225a96840f0ee67562a1db74ec9229890270b11e565d74f6eb01d30016aed
|
|
| MD5 |
a59720af9a739440b6a933879ac7637e
|
|
| BLAKE2b-256 |
5f01b1faa4f8c99bb3009de9566c5a265488c60c2f2c49a1758eebf366712601
|
File details
Details for the file mmseqs-1.0.0-cp38-cp38-manylinux2010_i686.manylinux_2_12_i686.whl.
File metadata
- Download URL: mmseqs-1.0.0-cp38-cp38-manylinux2010_i686.manylinux_2_12_i686.whl
- Upload date:
- Size: 35.8 MB
- Tags: CPython 3.8, manylinux: glibc 2.12+ i686
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
7126af5e0e2612c3a2878ae11730406e661a9f276bf59defe6ab6142bc37a681
|
|
| MD5 |
f34a1795f6ad8632299cd039e99fbb1d
|
|
| BLAKE2b-256 |
bd90905ac58e7b2db8e6a9329f6f973a3d04e741e105aca88fe55aa8329db371
|
File details
Details for the file mmseqs-1.0.0-cp38-cp38-macosx_10_15_x86_64.whl.
File metadata
- Download URL: mmseqs-1.0.0-cp38-cp38-macosx_10_15_x86_64.whl
- Upload date:
- Size: 11.0 MB
- Tags: CPython 3.8, macOS 10.15+ x86-64
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.3.0 pkginfo/1.7.0 requests/2.25.1 setuptools/53.0.0 requests-toolbelt/0.9.1 tqdm/4.56.0 CPython/3.8.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
94f21e665863aff59be8db50be7c56cb31b3c457736a0a287ce062734438a1cb
|
|
| MD5 |
5b25d7ef56ce14acc0c4b5827dccd170
|
|
| BLAKE2b-256 |
1cc2fb4f8031f9deb000e38ed97a1d1782cc0ba36ec3f93a9cf431a9160c1e20
|