Multiprocessing for Pathway-Tools
Project description
Pathway-Tools multiprocessing script
mpwt is a python package for running Pathway-Tools on multiple genomes using multiprocessing.
There is no guarantee that this script will work, it is a Work In Progress in early state.
Installation
Requirements
mpwt works only on Python 3 and it has been tested on Python 3.6. It requires some python packages (biopython, docopt and gffutils) and Pathway-Tools. To avoid issues, Pathway-Tools version 22.5 is required.
You must have an environment where Pathway-Tools is installed. Pathway-Tools can be obtained here. For some versions you need to have Blast installed on you system, for further informations look at this page.
If your OS doesn’t support Pathway-Tools, you can use a docker. If it’s your case, look at Pathway-Tools Multiprocessing Docker. It is a dockerfile that will create a container with Pathway-Tools, its dependencies and this package. You just need to give a Pathway-Tools installer as input.
You can also look at Pathway-Tools Multiprocessing Singularity. More manipulations are required compared to Docker but with this you can create a Singularity image.
Using pip
pip install mpwt
Use
Input data
The script takes a folder containing sub-folders as input. Each sub-folder contains a Genbank/GFF file. Genbank files must have the same name as the folder in which they are located and also finished with a .gbk or a .gff.
Folder_input
├── species_1
│ └── species_1.gbk
├── species_2
│ └── species_2.gff
│ └── species_2.fasta
├── species_3
│ └── species_3.gbk
..
Pathway-Tools will run on each Genbank/GFF file. It will create the results in the ptools-local folder but you can also choose an output folder.
Genbank file example:
LOCUS scaffold1 XXXXXX bp DNA linear INV DD-MMM-YYYY
DEFINITION My species genbank.
ACCESSION scaffold1
VERSION scaffold1
KEYWORDS Key words.
SOURCE Source
ORGANISM Species name
Taxonomy; Of; My; Species; With;
The; Genus.
FEATURES Location/Qualifiers
source 1..XXXXXX
/scaffold="scaffold1"
/db_xref="taxon:taxonid"
gene START..STOP
/locus_tag="gene1"
mRNA START..STOP
/locus_tag="gene1"
CDS START..STOP
/locus_tag="gene1"
/db_xref="InterPro:IPRXXXXXX"
/EC_number="X.X.X.X"
/translation="AMINOAACIDSSEQUENCE"
Look at the NCBI GBK format for more informations. You can also look at the example provided on Pathway-Tools site.
GFF file example:
##gff-version 3
##sequence-region scaffold_1 1 XXXXXX
scaffold_1 RefSeq region 1 XXXXXXX . + . ID=region_id;Dbxref=taxon:XXXXXX
scaffold_1 RefSeq gene START STOP . - . ID=gene_id
scaffold_1 RefSeq CDS START STOP . - 0 ID=cds_id;Parent=gene_id
Look at the NCBI GFF format for more informations.
You have to provide a nucleotide sequence file associated with the GFF file containing the chromosome/scaffold/contig sequence.
>scaffold_1
ATGATGCTGATACTGACTTAGCAT
Input files created by mpwt
Three input files are created by mpwt. Informations are extracted from the Genbank/GFF file. myDBName corresponds to the name of the folder and the Genbank/GFF file. taxonid corresponds to the taxonid in the db_xref of the source feature in the Genbank/GFF. species_name is extracted from the Genbank/GFF file.
organism-params.dat:
ID myDBName
STORAGE FILE
NCBI-TAXON-ID taxonid
NAME species_name
genetic-elements.dats:
NAME
ANNOT-FILE gbk_pathname
//
dat_creation.lisp:
(in-package :ecocyc)
(select-organism :org-id 'myDBName)
(let ((*progress-noter-enabled?* NIL))
(create-flat-files-for-current-kb))
Command Line Example
mpwt can be used as a command line.
mpwt -f path/to/folder/input [-o path/to/folder/output] [--patho] [--hf] [--dat] [--md] [--cpu INT] [-r] [--clean] [--log path/to/folder/log] [-v]
Optional argument are identified by [].
-f input folder as described in Input data.
-o output folder containing PGDB data or dat files (see –dat arguments).
–patho will launch PathoLogic inference on input folder.
–hf (to use with –patho) will launch PathoLogic Hole Filler with Blast.
–dat will create BioPAX/attribute-value dat files.
–md will move only the dat files inside the output folder.
–cpu the number of cpu used for the multiprocessing.
-r delete files in ptools-local to reduce size of results.
–log folder where log files for PathoLogic inference will be store.
-v print some information about the processing of mpwt.
–delete delete a specific PGDB inside the ptools-local folder.
–clean clean ptools-local folder, before any other operations.
Possible uses of mpwt:
mpwt -f path/to/folder/input --patho
Create PGDBs of studied organisms inside ptools-local.
mpwt -f path/to/folder/input --patho --hf
Create PGDBs of studied organisms inside ptools-local with the Hole-Filler.
mpwt -f path/to/folder/input --patho --dat
Create PGDBs of studied organisms inside ptools-local and create dat files.
mpwt -f path/to/folder/input --patho -o path/to/folder/output
Create PGDBs of studied organisms inside ptools-local. Then move the files to the output folder.
mpwt -f path/to/folder/input --patho --dat -o path/to/folder/output --md
Create PGDBs of studied organisms inside ptools-local and create dat files. Then move the dat files to the output folder.
mpwt --dat -o path/to/folder/output --md
Create dat files for the PGDB inside ptools-local. And move them to the output folder.
mpwt -o path/to/folder/output
Move PGDB from ptools-local to the output folder.
mpwt -o path/to/folder/output --md
Move dat files from ptools-local to the output folder.
Python Example
mpwt can be used in a python script with an import:
import mpwt
folder_input = "path/to/folder/input"
folder_output = "path/to/folder/output"
mpwt.multiprocess_pwt(folder_input, folder_output, patho_inference=optional_boolean, patho_hole_filler=optional_boolean, dat_creation=optional_boolean, dat_extraction=optional_boolean, size_reduction=optional_boolean, number_cpu=int, patho_log=optional_folder_pathname, verbose=optional_boolean)
folder_input: folder containing sub-folders with Genbank file inside.
folder_output: output folder where all the result of Pathway-Tools will be moved. This argument is optional. If you don’t enter an argument, results will be inside the ptools-local folder.
patho_inference: True or nothing. If True, mpwt will launch PathoLogic inference.
patho_hole_filler: True ir nothing. If True, mpwt will launch Pathway-Tools Hole Filler during PathoLogic inference.
dat_creation: True or nothing. If True, mpwt will create BioPAX/attribute-value dat files of the PGDBs.
dat_extraction: True or nothing. If True, mpwt will move the dat files inside the output folder instead of all the PGDB files.
size_reduction: True or nothing. If True, after moving the data to the output folder, mpwt will delete files in ptools-local. This to decrease the size of the results.
number_cpu: int or nothing. Number of cpu to use for the multiprocessing.
patho_log: string or nothing. String corresponds to a folder pathname. Will create log files of PathoLogic inference inside the folder.
verbose: True or nothing. If true, mpwt will be verbose.
Useful functions
multiprocess_pwt(folder_input, folder_output, patho_inference=optional_boolean, dat_creation=optional_boolean, dat_extraction=optional_boolean, size_reduction=optional_boolean, number_cpu=int, verbose=optional_boolean)
Run the multiprocess Pathway-Tools on input folder.
cleaning()
Delete all the previous PGDB and the metadata files.
This can also be used with a command line argument:
mpwt --clean
If you use clean and the argument -f input_folder, it will delete input files (‘dat_creation.lisp’, ‘pathologic.log’, ‘genetic-elements.dat’ and ‘organism-params.dat’).
mpwt --clean -f input_folder
remove_pgbds(pgdb_name)
With this command, it is possible to delete a specified db, where pgdb_name is the name of the PGDB (ending with ‘cyc’). It can be multiple pgdbs, to do this, put all the pgdb IDs in a string separated by a ‘,’.
And as a command line:
mpwt --delete mydbcyc1,mydbcyc2
ptools_path()
Return the path to ptools-local.
list_pgdb()
Return a list containing all the PGDBs inside ptools-local folder. Can be used as a command with:
mpwt --list
Errors
If you encounter errors (and it is highly possible) there is some tips that can help you resolved them.
For error during PathoLogic inference, you can use the log arguments. The log contains the summary of the build and the error for each species. There is also a pathologic.log in each sub-folders.
If the build passed you have also the possibility to see the result of the inference with the file resume_inference.tsv. For each species, it contains the number of genes/proteins/reactions/pathways/compounds in the metabolic network.
If Pathway-Tools crashed, mpwt can print some useful information in verbose mode.
Output
If you did not use the output argument, results (PGDB with/without BioPAX/dat files) will be inside your ptools-local folder ready to be used with Pathway-Tools. Have in mind that mpwt does not create the cellular overview and does not used the hole-filler. So if you want these results you should run them after.
If you used the output argument, there is two potential outputs depending on the use of the option –md/dat_extraction:
without this option, you will have a complete PGDB folder inside your results, for example:
Folder_output
├── species_1
│ └── default-version
│ └── 1.0
│ └── data
│ └── contains BioPAX/dat files if you used the --dat/dat_creation option.
│ └── input
│ └── species_1.gbk
│ └── genetic-elements.dat
│ └── organism-init.dat
│ └── organism.dat
│ └── kb
│ └── species_1.ocelot
│ └── reports
│ └── contains Pathway-Tools reports.
├── species_2
..
├── species_3
..
with this option, you will only have the dat files, for example:
Folder_output
├── species_1
│ └── classes.dat
│ └── compounds.dat
│ └── dnabindsites.dat
│ └── enzrxns.dat
│ └── genes.dat
│ └── pathways.dat
│ └── promoters.dat
│ └── protein-features.dat
│ └── proteins.dat
│ └── protligandcplxes.dat
│ └── pubs.dat
│ └── reactions.dat
│ └── regulation.dat
│ └── regulons.dat
│ └── rnas.dat
│ └── species.dat
│ └── terminators.dat
│ └── transunits.dat
│ └── ..
├── species_2
..
├── species_3
..
Release Notes
Changes between version are listed on the release page.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
File details
Details for the file mpwt-0.4.1.tar.gz
.
File metadata
- Download URL: mpwt-0.4.1.tar.gz
- Upload date:
- Size: 16.8 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/1.9.1 pkginfo/1.3.2 requests/2.20.0 setuptools/40.8.0 requests-toolbelt/0.8.0 tqdm/4.19.5 CPython/3.6.8
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | 45d0233edb00836497207dcf739cba5f88ea6c9c33075cefa8e7a149dae9c819 |
|
MD5 | a71f9b9f22a63e0ebf5d7fbf81142a74 |
|
BLAKE2b-256 | 4d15b3776695d6987d8bec6595ddef2616200e66ccc50203633afaf4bd5c64d0 |