Multiprocessing for Pathway Tools
Project description
mpwt: Pathway Tools multiprocessing wrapper
mpwt is a python package for running Pathway Tools on multiple genomes using multiprocessing.
There is no guarantee that this script will work, it is a Work In Progress in early state.
Installation
Requirements
mpwt works only on Python 3 and it has been tested on Python 3.6. It requires some python packages (biopython, docopt and gffutils) and Pathway Tools. For the multiprocessing, mpwt uses the multiprocessing library of Python 3.
You must have an environment where Pathway Tools is installed. Pathway Tools can be obtained here.
Pathway Tools needs Blast, so it must be install on your system. Depending on your system, Pathway Tools needs a file named .ncbirc to locate Blast, for more informations look at this page.
If your OS doesn’t support Pathway Tools, you can use a docker. If it’s your case, look at Pathway Tools Multiprocessing Docker. It is a dockerfile that will create a container with Pathway Tools, its dependencies and this package. You just need to give a Pathway Tools installer as input.
You can also look at Pathway Tools Multiprocessing Singularity. More manipulations are required compared to Docker but with this you can create a Singularity image.
Using pip
pip install mpwt
Use
Input data
The script takes a folder containing sub-folders as input. Each sub-folder contains a Genbank/GFF file or multiple PathoLogic Format (PF) files.
Folder_input
├── species_1
│ └── species_1.gbk
├── species_2
│ └── species_2.gff
│ └── species_2.fasta
├── species_3
│ └── species_3.gbk
├── species_4
│ └── scaffold_1.pf
│ └── scaffold_1.fasta
│ └── scaffold_2.pf
│ └── scaffold_2.fasta
taxon_id.tsv
..
Genbank files must have the same name as the folder in which they are located and also finished with a .gbk or a .gff.
For PF files, there is one file for each scaffold/contig and one corresponding fasta file.
Pathway Tools will run on each Genbank/GFF/PF files. It will create the results in the ptools-local folder but you can also choose an output folder.
Genbank
Genbank file example:
LOCUS scaffold1 XXXXXX bp DNA linear INV DD-MMM-YYYY
DEFINITION My species genbank.
ACCESSION scaffold1
VERSION scaffold1
KEYWORDS Key words.
SOURCE Source
ORGANISM Species name
Taxonomy; Of; My; Species; With;
The; Genus.
FEATURES Location/Qualifiers
source 1..XXXXXX
/scaffold="scaffold1"
/db_xref="taxon:taxonid"
gene START..STOP
/locus_tag="gene1"
mRNA START..STOP
/locus_tag="gene1"
CDS START..STOP
/locus_tag="gene1"
/db_xref="InterPro:IPRXXXXXX"
/go_component="GO:XXXXXXX"
/EC_number="X.X.X.X"
/translation="AMINOAACIDSSEQUENCE"
Look at the NCBI GBK format for more informations. You can also look at the example provided on Pathway Tools site.
GFF
GFF file example:
##gff-version 3
##sequence-region scaffold_1 1 XXXXXX
scaffold_1 RefSeq region 1 XXXXXXX . + . ID=region_id;Dbxref=taxon:XXXXXX
scaffold_1 RefSeq gene START STOP . - . ID=gene_id
scaffold_1 RefSeq CDS START STOP . - 0 ID=cds_id;Parent=gene_id
Warning: it seems that metabolic networks from GFF file have less reactions/pathways/compounds than metabolic networks from Genbank file. Lack of some annotations (EC, GO) can be the reason explaining these differences.
Look at the NCBI GFF format for more informations.
You have to provide a nucleotide sequence file associated with the GFF file containing the chromosome/scaffold/contig sequence.
>scaffold_1
ATGATGCTGATACTGACTTAGCAT
PathoLogic Format
PF file example:
;;;;;;;;;;;;;;;;;;;;;;;;;
;; scaffold_1
;;;;;;;;;;;;;;;;;;;;;;;;;
ID gene_id
NAME gene_id
STARTBASE START
ENDBASE STOP
FUNCTION ORF
PRODUCT-TYPE P
PRODUCT-ID prot gene_id
EC X.X.X.X
DBLINK GO:XXXXXXX
INTRON START1-STOP1
//
Look at the Pathologic format for more informations.
You have to provide one nucleotide sequence for each pathologic containing one scaffold/contig.
>scaffold_1
ATGATGCTGATACTGACTTAGCAT
Also to add the taxon ID we need the taxon_id.tsv (a tsv file with two values: the name of the folder containing the PF files and the taxon ID corresponding).
species |
taxon_id |
---|---|
species_4 |
4 |
If you don’t have taxon ID in your Genbank or GFF file, you can add one in this file for the corresponding species.
You can also add more informations for the genetic elements like circularity of genome (Y or N), type of genetic element (:CHRSM, :PLASMID, :MT (mitochondrial chromosome), :PT (chloroplast chromosome), or :CONTIG) or codon table (see the corresponding code below).
Example:
species |
taxon_id |
circular |
element_type |
codon_table |
corresponding_file |
---|---|---|---|---|---|
species_1 |
10 |
Y |
:CHRSM |
1 |
|
species_4 |
4 |
N |
:CHRSM |
1 |
scaffold_1 |
species_4 |
4 |
N |
:MT |
1 |
scaffold_2 |
As you can see for PF file (species_4) you can use the column corresponding_file to add information for each PF files.
Genetic code for Pathway Tools:
Corresponding number |
Genetic code |
---|---|
0 |
Unspecified |
1 |
The Standard Code |
2 |
The Vertebrate Mitochondrial Code |
3 |
The Yeast Mitochondrial Code |
4 |
The Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code |
5 |
The Invertebrate Mitochondrial Code |
6 |
The Ciliate, Dasycladacean and Hexamita Nuclear Code |
9 |
The Echinoderm and Flatworm Mitochondrial Code |
10 |
The Euplotid Nuclear Code |
11 |
The Bacterial, Archaeal and Plant Plastid Code |
12 |
The Alternative Yeast Nuclear Code |
13 |
The Ascidian Mitochondrial Code |
14 |
The Alternative Flatworm Mitochondrial Code |
15 |
Blepharisma Nuclear Code |
16 |
Chlorophycean Mitochondrial Code |
21 |
Trematode Mitochondrial Code |
22 |
Scenedesmus obliquus Mitochondrial Code |
23 |
Thraustochytrium Mitochondrial Code |
Input files created by mpwt
Three input files are created by mpwt. Informations are extracted from the Genbank/GFF/PF file. myDBName corresponds to the name of the folder and the Genbank/GFF/PF file. taxonid corresponds to the taxonid in the db_xref of the source feature in the Genbank/GFF/PF. The species_name is extracted from the Genbank/GFF/PF files.
**organism-params.dat**
ID myDBName
STORAGE FILE
NCBI-TAXON-ID taxonid
NAME species_name
**genetic-elements.dats**
NAME
ANNOT-FILE gbk_pathname
//
**dat_creation.lisp**
(in-package :ecocyc)
(select-organism :org-id 'myDBName)
(let ((*progress-noter-enabled?* NIL))
(create-flat-files-for-current-kb))
Command Line and Python arguments
mpwt can be used with the command line:
mpwt -f path/to/folder/input [-o path/to/folder/output] [--patho] [--hf] [--dat] [--md] [--cpu INT] [-r] [--clean] [--log path/to/folder/log] [--ignore-error] [-v]
Optional argument are identified by [].
mpwt can be used in a python script with an import:
import mpwt
folder_input = "path/to/folder/input"
folder_output = "path/to/folder/output"
mpwt.multiprocess_pwt(input_folder=folder_input,
output_folder=folder_output,
patho_inference=optional_boolean,
patho_hole_filler=optional_boolean,
dat_creation=optional_boolean,
dat_extraction=optional_boolean,
size_reduction=optional_boolean,
number_cpu=int,
patho_log=optional_folder_pathname,
ignore_error=optional_boolean,
taxon_file=optional_boolean,
verbose=optional_boolean)
Command line argument |
Python argument |
description |
---|---|---|
-f |
input_folder(string: folder pathname) |
input folder as described in Input data |
-o |
output_folder(string: folder pathname) |
output folder containing PGDB data or dat files (see –dat arguments) |
–patho |
patho_inference(boolean) |
launch PathoLogic inference on input folder |
–hf |
patho_hole_filler(boolean) |
launch PathoLogic Hole Filler with Blast |
–dat |
dat_creation(boolean) |
Create BioPAX/attribute-value dat files |
–md |
dat_extraction(boolean) |
Move only the dat files inside the output folder |
–cpu |
number_cpu(int) |
Number of cpu used for the multiprocessing |
-r |
size_reduction(boolean) |
Delete PGDB in ptools-local to reduce size and return compressed files |
–log |
patho_log(string: folder pathname) |
Folder where log files for PathoLogic inference will be store |
–delete |
mpwt.remove_pgdbs(string: pgdb name) |
Delete a specific PGDB |
–clean |
mpwt.cleaning() |
Delete all PGDBs in ptools-local folder or only PGDB from input folder |
–ignore-error |
ignore_error(boolean) |
Ignore errors and continue the workflow for successful build |
–taxon-file |
taxon_file(boolean) |
Force mpwt to use the taxon ID in the taxon_id.tsv file |
-v |
verbose(boolean) |
Print some information about the processing of mpwt |
Examples
Possible uses of mpwt:
command line
import mpwt python script
Create PGDBs of studied organisms inside ptools-local:
mpwt -f path/to/folder/input --patho
import mpwt mpwt.multiprocess_pwt(input_folder='path/to/folder/input', patho_inference=True)
Create PGDBs of studied organisms inside ptools-local with the Hole-Filler:
mpwt -f path/to/folder/input --patho --hf --log path/to/folder/log
import mpwt mpwt.multiprocess_pwt(input_folder='path/to/folder/input', patho_inference=True, patho_hole_filler=True, patho_log='path/to/folder/log')
Create PGDBs of studied organisms inside ptools-local and create dat files:
mpwt -f path/to/folder/input --patho --dat
import mpwt mpwt.multiprocess_pwt(input_folder='path/to/folder/input', patho_inference=True, dat_creation=True)
Create PGDBs of studied organisms inside ptools-local. Then move the files to the output folder.
mpwt -f path/to/folder/input --patho -o path/to/folder/output
import mpwt mpwt.multiprocess_pwt(input_folder='path/to/folder/input', output_folder='path/to/folder/output', patho_inference=True)
Create PGDBs of studied organisms inside ptools-local and create dat files. Then move the dat files to the output folder.
mpwt -f path/to/folder/input --patho --dat -o path/to/folder/output --md
import mpwt mpwt.multiprocess_pwt(input_folder='path/to/folder/input', output_folder='path/to/folder/output', patho_inference=True, dat_creation=True, dat_extraction=True)
Create dat files for the PGDB inside ptools-local. And move them to the output folder.
mpwt --dat -o path/to/folder/output --md
import mpwt mpwt.multiprocess_pwt(output_folder='path/to/folder/output', dat_creation=True, dat_extraction=True)
Move PGDB from ptools-local to the output folder:
mpwt -o path/to/folder/output
import mpwt mpwt.multiprocess_pwt(output_folder='path/to/folder/output')
Move dat files from ptools-local to the output folder:
mpwt -o path/to/folder/output --md
import mpwt mpwt.multiprocess_pwt(output_folder='path/to/folder/output', dat_extraction=True)
Useful functions
Run the multiprocess Pathway Tools on input folder
import mpwt mpwt.multiprocess_pwt(input_folder, output_folder, patho_inference=optional_boolean, dat_creation=optional_boolean, dat_extraction=optional_boolean, size_reduction=optional_boolean, number_cpu=int, verbose=optional_boolean)
Delete all the previous PGDB and the metadata files
import mpwt mpwt.cleaning()
This can also be used with a command line argument:
mpwt --clean
If you use clean and the argument -f input_folder, it will delete input files (‘dat_creation.lisp’, ‘pathologic.log’, ‘genetic-elements.dat’ and ‘organism-params.dat’) and the PGDB corresponding to the input folder.
mpwt -f input_folder --clean
For example if you have:
Folder_input ├── species_1 │ └── species_1.gbk ├── species_2 │ └── species_2.gff │ └── species_2.fasta ├── species_3 │ └── species_3.gbk
And you have in your ptools-local:
ptools-local ├── pgdbs ├── user ├── species_1cyc │ └── .. ├── species_2cyc │ └── .. ├── species_3cyc │ └── .. ├── species_4cyc │ └── ..
The command:
mpwt -f input_folder --clean
will delete species_1cyc, species_2cyc and species_3cyc but not species_4cyc.
Delete a specific PGDB
With this command, it is possible to delete a specific PGDB, where pgdb_name is the name of the PGDB (ending with ‘cyc’). It can be multiple pgdbs, to do this, put all the pgdb IDs in a string separated by a ‘,’.
import mpwt mpwt.remove_pgdbs(pgdb_name)
And as a command line:
mpwt --delete mydbcyc1,mydbcyc2
Return the path of ptools-local
import mpwt ptools_local_path = mpwt.find_ptools_path()
Return a list containing all the PGDBs inside ptools-local folder
import mpwt list_of_pgdbs = mpwt.list_pgdb()
Can be used as a command with:
mpwt --list
Errors
If you encounter errors (and it is highly possible) there is some tips that can help you resolved them.
For error during PathoLogic inference, you can use the log arguments. The log contains the summary of the build and the error for each species. There is also a pathologic.log in each sub-folders.
If the build passed you have also the possibility to see the result of the inference with the file resume_inference.tsv. For each species, it contains the number of genes/proteins/reactions/pathways/compounds in the metabolic network.
If Pathway Tools crashed, mpwt can print some useful information in verbose mode. It will show the terminal in which Pathway Tools has crashed. Also, if there is an error in pathologic.log, it will be shown after === Error in Pathologic.log ===.
There is a Pathway Tools forum where you can find informations on Pathway Tools errors.
You can also ignore PathoLogic errors by using the argument –ignore-error/ignore_error. This option will ignore error and continue the mpwt workflow on the successful PathoLogic build.
Output
If you did not use the output argument, results (PGDB with/without BioPAX/dat files) will be inside your ptools-local folder ready to be used with Pathway Tools. Have in mind that mpwt does not create the cellular overview and does not used the hole-filler. So if you want these results you should run them after.
If you used the output argument, there is two potential outputs depending on the use of the option –md/dat_extraction:
without –md/dat_extraction, you will have a complete PGDB folder inside your results, for example:
Folder_output
├── species_1
│ └── default-version
│ └── 1.0
│ └── data
│ └── contains BioPAX/dat files if you used the --dat/dat_creation option.
│ └── input
│ └── species_1.gbk
│ └── genetic-elements.dat
│ └── organism-init.dat
│ └── organism.dat
│ └── kb
│ └── species_1.ocelot
│ └── reports
│ └── contains Pathway Tools reports.
├── species_2
..
├── species_3
..
with –md/dat_extraction, you will only have the dat files, for example:
Folder_output
├── species_1
│ └── classes.dat
│ └── compounds.dat
│ └── dnabindsites.dat
│ └── enzrxns.dat
│ └── genes.dat
│ └── pathways.dat
│ └── promoters.dat
│ └── protein-features.dat
│ └── proteins.dat
│ └── protligandcplxes.dat
│ └── pubs.dat
│ └── reactions.dat
│ └── regulation.dat
│ └── regulons.dat
│ └── rnas.dat
│ └── species.dat
│ └── terminators.dat
│ └── transunits.dat
│ └── ..
├── species_2
..
├── species_3
..
with the -r /size_reduction argument, you will have compressed zip files (and PGDBs inside ptools-local will be deleted):
Folder_output
├── species_1.zip
├── species_2.zip
├── species_3.zip
..
Release Notes
Changes between version are listed on the release page.
Citation
Arnaud Belcour, Clémence Frioux, Meziane Aite, Anthony Bretaudeau, Anne Siegel (2019) Metage2Metabo: metabolic complementarity applied to genomes of large-scale microbiotas for the identification of keystone species. bioRxiv 803056; doi: https://doi.org/10.1101/803056.
Acknowledgements
Mézaine Aite for his work on the first draft of this package.
Clémence Frioux for her work and feedbacks.
Peter Karp, Suzanne Paley, Markus Krummenacker, Richard Billington and Anamika Kothari from the Bioinformatics Research Group of SRI International for their help on Pathway Tools and on Genbank format.
GenOuest bioinformatics (https://www.genouest.org/) core facility for providing the computing infrastructure to test this tool.
All the users that have tested this tool.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
File details
Details for the file mpwt-0.5.2.tar.gz
.
File metadata
- Download URL: mpwt-0.5.2.tar.gz
- Upload date:
- Size: 33.8 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/1.9.1 pkginfo/1.5.0.1 requests/2.21.0 setuptools/40.8.0 requests-toolbelt/0.9.1 tqdm/4.19.5 CPython/3.6.8
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | dc8b9ce06904a5d3ed4d19ae696ee4c276ebcdd83a2d3554dcee03e009091a5b |
|
MD5 | c09e90465115d6a90647ce6565ecfcd9 |
|
BLAKE2b-256 | a14019e67302e6b3de6b046972e6aa55fa1ae0e8efc6625a4bec60ff24be5962 |