Skip to main content

No project description provided

Project description

multiPrime

multiPrime is an error-tolerant primer design tool for broad-spectrum pathogens detection. It proposes a solution for the maximal coverage degenerate primer design with error (MD-EDPD). version 2.4.2 is equal to the multiPrime pipeline (2.1.1) in https://github.com/joybio/multiPrime.

1. Install

pip

pip3 install multiPrime
  • pip python >=3.9

2. Usage

$ multiPrime -h 

Parameters:

Parameters Description
DPrime Degenerate primer design through MD-EDPD or MD-DPD.
Ppair Primer pair selection from the result of multiPrime DPrime.
Perfect Extract primer-contained sequences with non-mismatches.
Errors Extract primer-contained sequences with errors.
multiPrime DPrime -i input -o output
           Options: { -l [18] -n [4] -d [10] -v [1] -g [0.2,0.7] -f [0.8] -c [4] -p [10] -a [4] }

Parameters:

Parameters Description
-i/--input Input file: Result of multi-alignment. (muscle, mafft or others)
-l/--plen Length of primer. Default: 18
-n/--dnum Number of degenerate. Default: 4.
-v/--variation Max mismatch number of primer. Default: 1.
-e/--entropy Entropy is actually a measure of disorder. This parameter is used to judge whether the window is conservation. Entropy of primer-length window. Default: 3.6.
-g/--gc Filter primers by GC content. Default [0.2,0.7].
-s/--size Number of degenerate. Default: 4.
-f/--fraction Filter primers by match fraction (Coverage with errors). Default: 0.8.
-c/--coordinate Mismatch index is not allowed to locate in your specific positions. otherwise, it won't be regard as the mis-coverage. With this param, you can control the index of Y-distance (number=variation and position of mismatch). when calculate coverage with error. coordinate>0: 5'==>3'; coordinate<0: 3'==>5'. You can set this param to any value that you prefer. Default: 1,-1. 1: I dont want mismatch at the 2nd position, start from 0. -1: I dont want mismatch at the -1st position, start from -1.
-p/--proc Number of process to launch. Default: 20.
-a/--away Filter hairpin structure, which means distance of the minimal paired bases. Default: 4. Example:(number of X) AGCT[XXXX]AGCT. Primers should not have complementary sequences (no consecutive 4 bp complementarities),otherwise the primers themselves will fold into hairpin structure.
-o/--out Output file: candidate primers. e.g. [*].candidate.primers.out.
multiPrime Ppair -i input -r reference -o output
           Options: {-f [0.6] -m [500] -n [200] -e [4] -p [9] -s [250,500] -g [0.4,0.6] -d [4] -a ","}

Parameters:

Parameters Description
-i/--input Input file: output of multiPrime DPrime.
-r/--ref Reference sequence file: all the sequence in 1 fasta, for example: (Cluster_96_171.tfa).
-g/--gc Filter primers by GC content. Default [0.2,0.7].
-f/--fraction Filter primers by match fraction. Default: 0.6. Sometimes you need a small fraction to get output.
-e/--end Filter primers by degenerate base position. e.g. [-e 4] means I dont want degenerate base appear at the end four bases when primer pre-filter. Default: 4.
-s/--size Filter primers by PRODUCT size. Default [250,500].
-d/--dist Filter param of hairpin, which means distance of the minimal paired bases. Default: 4. Example:(number of X) AGCT[XXXX]AGCT.
-t/--tm Difference of Tm between primer-F and primer-R. Default: 5.
-p/--proc Number of process to launch. Default: 20.
-a/--adaptor Adaptor sequence, which is used for NGS next. Hairpin or dimer detection for [adaptor--primer]. example: TCTTTCCCTACACGACGCTCTTCCGATCT,TCTTTCCCTACACGACGCTCTTCCGATCT (Default). If you dont want adaptor, use [","]
-m/--maxseq Limit of sequence number. Default: 0. If 0, then all sequence will take into account. This param should consistent with [max_seq] in multi-alignment.
-o/--out Output file: candidate primer pairs. e.g. [*].candidate.primers.txt.
multiPrime Perfect -i [input] -p [10] -f [format] -o [output] -s [Coverage.xls]

Parameters:

Parameters Description
-i/--input Input file: Primer file. One of the followed three types: final_maxprimers_set.xls (see output of multiPrime in github (https://github.com/joybio/multiPrime)); primer.fa (primer fasta) or primer_F,primer_R.
-r/--ref Sequence file: all the input sequences in 1 fasta.
-f/--format Format of primer file: xls or fa or seq; default: xls, indicate final_maxprimers_set.xls. xls: final_primer_set.xls; fa:fasta format or seq: sequence format, comma seperate. e.g. primer_F,Primer_R.
-p/--process Number of process to launch. Default: 20.
-o/--out Output_dir. default: PCR_product.
-s/--stast Stast information: number of coverage and total. Default: Coverage.xls.
multiPrime Errors -i [input] -r [bowtie index] -l [150,2000] -p [10]-o [output]

Parameters:

Parameters Description
-i/--input input file: primer.fa.
-r/--ref reference file: the fasta of raw input.
-l/--len Length of primer, which is used for mapping. Default: 18
-t/--term Position of mismatch is not allowed in the 3 term of primer. Default: 4
-b/--bowtie bowtie or bowtie2 was employed for mapping. Default: bowtie2
-m/--seedmms Bowtie: Mismatches in seed (can be 0 - 3, default: -n 1).Bowtie2: Gap or mismatches in seed (can be 0 - 1, default: -n 1).
-p/--process Number of process to launch. Default: 20.
-o/--out Output file: PCR product with primers.

3. Results

multiPrime DPrime

  • output:Information of primer.
  • output.gap_seq_id_json: Positions and non-contained sequences caused by errors (number of errors are greater than threshold).
  • output.non_coverage_seq_id_json: Positions and non-contained sequences.

multiPrime Ppair

  • output:*.candidate.primers.txt

multiPrime Perfect

  • output:PCR_product
  • Coverage.xls:Total coverage for all primers.

multiPrime Errors

  • output:PCR product with primer pairs.
  • output.pair.num:Target amplicon number with primer pairs.
  • others:Temp files.

4. test dir

multiPrime/example

5. Contact

Please send comments, suggestions, bug reports and bug fixes to 1806389316@pku.edu.cn

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

multiPrime-2.4.3.tar.gz (28.7 kB view hashes)

Uploaded Source

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page