Search and fetch the Species Latin names, Accessory Number, Sequence Length, Division, Collection Country, Collection Date, Collected Worker, Identified Worker, and Reference information, etc. of the search records as tabular files.
Project description
NCBI-Parser
Search any term from all NCBI databases to obtain matched entries, and download all NCBI GenBank format files and sequences corresponding to accessory number in genbank directory, finally export all Species Latin names, Accessory Number, Sequence Length, Division, Collection Country, Collection Date, Collected Worker, Identified Worker, and Reference information, etc. of the search records as tabular files.
Usage
ncbi-parser.exe --help
Usage: ncbi-parser.exe [OPTIONS]
Description: Search any term from all NCBI databases to obtain matched
entries, and download all NCBI GenBank format files and sequences
corresponding to accessory number in genbank directory, finally export all
Species Latin names, Accessory Number, Sequence Length, Division, Collection
Country, Collection Date, Collected Worker, Identified Worker, and Reference
information, etc. of the search records as tabular files.
1. Get options and parameters help:
ncbi-parser --help
2. Example (simple information). Users only need to input the search term,
and the default search is in NCBI nucleotide database:
ncbi-parser --term "Acanthopagrus 16S" --output results.xls
3. Example (complete information). Specify the NCBI database type, input the
search term, specify the number of records to download and extract, and
suggest setting a larger parameter max_record:
ncbi-parser --db_type nucleotide --term "Acanthopagrus 16S" --max_record 500
--res_type gb --output results.xls
Options:
--db_type TEXT Please input NCBI database type, default: "nucleotide",
including: [pubmed, protein, nuccore, ipg, nucleotide,
structure, genome, annotinfo, assembly, bioproject,
biosample, blastdbinfo, books, cdd, clinvar, gap,
gapplus, grasp, dbvar, gene, gds, geoprofiles,
homologene, medgen, mesh, ncbisearch, nlmcatalog, omim,
orgtrack, pmc, popset, proteinclusters, pcassay, protfam,
pccompound, pcsubstance, seqannot, snp, sra, taxonomy,
biocollections, gtr] [required]
--term TEXT Please input search term content, default: "Acanthopagrus
16S" [required]
--max_record TEXT Please input max record number, default: "100", up to:
10000 [required]
--res_type TEXT Please input result type, default: "gb", including:
["gb", "fasta", "gbwithparts", "gbcoll"]
--output TEXT Please input output full name (path + name + extension).
default="results.xls"
--help Show this message and exit.
NCBI GenBank format
LOCUS LC649152 1081 bp DNA linear VRT 03-SEP-2021
DEFINITION Acanthopagrus bifasciatus Kuroshio Biological Research Foundation
KBF-I 361 mitochondrial genes for 12S rRNA, tRNA-Val, 16S rRNA,
partial and complete sequence.
ACCESSION LC649152
VERSION LC649152.1
KEYWORDS .
SOURCE mitochondrion Acanthopagrus bifasciatus (twobar seabream)
ORGANISM Acanthopagrus bifasciatus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
Acanthomorphata; Eupercaria; Spariformes; Sparidae; Acanthopagrus.
REFERENCE 1
AUTHORS Sado,T., Fukuchi,T. and Miya,M.
TITLE Reference data for MiFish metabarcoding analysis
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 1081)
AUTHORS Sado,T., Fukuchi,T. and Miya,M.
TITLE Direct Submission
JOURNAL Submitted (27-AUG-2021) Contact:Tetsuya Sado Natural History Museum
& Institute, Chiba; 955-2 Aoba-cho, Chuo-ku, Chiba, Chiba 260-8682,
Japan URL :http://www2.chiba-muse.or.jp/NATURAL/
FEATURES Location/Qualifiers
source 1..1081
/organism="Acanthopagrus bifasciatus"
/organelle="mitochondrion"
/mol_type="genomic DNA"
/specimen_voucher="Kuroshio Biological Research Foundation
KBF-I 361"
/db_xref="taxon:767411"
/PCR_primers="fwd_name: L-708-12S, fwd_seq:
ttayacatgcaagtatccgc, rev_name: H-1784-16SG, rev_seq:
ttcagctttcccttgcggtac"
rRNA <1..894
/product="12S ribosomal RNA"
tRNA 895..967
/product="tRNA-Val"
rRNA 968..>1081
/product="16S ribosomal RNA"
ORIGIN
1 acccccgtga aaatgcccta cagttccccg cccggaaaca aggagccggt atcaggcaca
61 ttcaatttag cccacgacac cttgctcagc cacaccctca agggtactca gcagtgataa
121 accttgacac ataagtgaaa acttgaatca gttaaagcta agtagggccg gtaaaactcg
181 tgccagccac cgcggttata cgagaggccc aagttgttag aaatcggcgt aaagggtggt
241 taagaataag attaaaatta aagccgaaca tctttagtag ctgttatacg ctttcaaaga
301 caagaagccc aactgcgaaa gtagctttat attttctgaa cccacgaaag ctaaggtaca
361 aactgggatt agatacccca ctatgcttag ccgtaaacat cgacagttta ttacattttc
421 tgtccgcctg ggtactacaa gcattagctc aaaacccaaa ggacttggcg gtgctttaga
481 cccacctaga ggagcctgtt ctagaaccga tattccccgt tcaacctcac ctctccttgc
541 ctctcagcct atataccgcc gtcgttcagc ttaccctgtg aagggcaaaa agtaagcaaa
601 attggcactg cccagtacgt caggtcgagg tgtagtcaat ggagtgggaa gaaatgggct
661 acattccctt gtcttcaggg aactacgaat ggtgcactga aaatgtgtgc ctgaaggagg
721 atttagcagt aagtagtaat ttagaatatt ctactgaagc cggctcttaa gcgcgcacac
781 accgcccgtc actctccccg agactttaaa ttcacattaa ctaaaatatt aaatatcata
841 gaggggaggc aagtcgtaac atggtaagtg taccggaagg tgtacttgga aaaccagcgc
901 atagctaaac tagataaagc acctccctta cactgagaag atattcgtgc aaatcgaatt
961 gccctgagcc tatcagctag ccctctaaca aaaaacaaca cacccccatc aattaacccc
1021 caatgcactt acattaaatt aaacaaatca tttttccacc caagtatggg cgacagaaaa
1081 g
//
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Hashes for ncbiparser-1.0.0-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | 99b4fcfe90429a9687ad7c505998413bb8a7ff5c01ce5614aba899835132e4e2 |
|
MD5 | 46facde3d5b09b4d1eafdcc933ff880e |
|
BLAKE2b-256 | da751fa8796e57e80b2e7ebaf0a1f16d0f57c14867539f9395c25a8a1091aba6 |