Skip to main content

Track-seq data analysis

Project description

OFF-TRACKER

OFF-TRACKER is an end to end pipeline of Track-seq data analysis for detecting off-target sites of any genome editing tools that generate double-strand breaks (DSBs) or single-strand breaks (SSBs).

System requirements

  • Linux/Unix
  • Python >= 3.6

Dependency

# We recommend creating a new enviroment using mamba/conda to avoid compatibility problems
# If you don't use mamba, just replace the code with conda 
mamba create -n offtracker -c bioconda blast snakemake pybedtools

Installation

# activate the environment
conda activate offtracker

# Direct installation with pip
pip install offtracker

# (Alternative) Download the offtracker from github
git clone https://github.com/Lan-lab/offtracker.git 
cd offtracker
pip install .

Before analyzing samples

# Build blast index (only need once for each genome)
makeblastdb -input_type fasta -title hg38 -dbtype nucl -parse_seqids \
-in /Your_Path_To_Reference/hg38_genome.fa \
-out /Your_Path_To_Reference/hg38_genome.blastdb \
-logfile /Your_Path_To_Reference/hg38_genome.blastdb.log

# Build chromap index (only need once for each genome)
chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
-o /Your_Path_To_Reference/hg38_genome.chromap.index

# Generate candidate regions by sgRNA sequence (need once for each genome and sgRNA)
offtracker_candidates.py -t 8 -g hg38 \
-r /Your_Path_To_Reference/hg38_genome.fa \
-b /Your_Path_To_Reference/hg38_genome.blastdb \
--name 'HEK4' --sgrna 'GGCACTGCGGCTGGAGGTGG' --pam 'NGG' \
-o /Your_Path_To_Candidates

Strand-specific mapping of Track-seq data

# Generate snakemake config file 
offtracker_config.py -t 8 -g hg38 --blacklist hg38 \
-r /Your_Path_To_Reference/hg38_genome.fa \
-i /Your_Path_To_Reference/hg38_genome.chromap.index \
-f /Your_Path_To_Fastq \
-o /Your_Path_To_Output \ 
--subfolder 0 

# --subfolder: If different samples are in seperate folders, set this to 1
# -o: Default is outputting to /Your_Path_To_Fastq

# Run the snakemake program
cd /Your_Path_To_Fastq
snakemake -np # dry run
nohup snakemake --cores 16 1>snakemake.log 2>snakemake.err &

## about cores
# --cores of snakemake must be larger than -t of offtracker_config.py
# parallel number = cores/t

## about output
# This part will generate "*.fw.scaled.bw" and ".rv.scaled.bw" for IGV visualization
# "*.fw.bed" and "*.rv.bed" are used in the next part.

Analyzing the off-target sites

# In this part, multiple samples in the same condition can be analyzed in a single run by pattern recogonization of sample names

offtracker_analysis.py -g hg38 --name "HEK4" \
--exp 'Cas9_HEK4.*293' \
--control 'control' \
--outname 'Cas9_HEK4_293' \
-f /Your_Path_To_Output \
--seqfolder /Your_Path_To_Candidates

# --name: the same as that in offtracker_candidates.py
# --exp/--control: add one or multiple patterns of file name in regex


# This step will generate Trackseq_result_{outname}.csv
# Intermediate files are saved in ./temp folder, which can be deleted 
# Keeping the intermediate files can make the analysis faster if involving previously analyzed samples (e.g. using the same control samples for different analyses)

Note1

The default setting only includes chr1-chr22, chrX, chrY, and chrM.

Please make sure the reference genome contains "chr" at the beginning.

If you have requirement for other chromosomes or species other than human/mouse, please post an issue.

Note2

Currently, this software is only ready-to-use for mm10 and hg38.

For any other genome, say hg19, please add genome size file named "hg19.chrom.sizes" to .\offtracker\mapping before install.

Besides, add "--blacklist none" or "--blacklist Your_Blacklist" when running offtracker_config.py

Note3

The FDR in the Track-seq result is not rigorous to the real off-target probability. It is strongly recommended to observe the "fw.scaled.bw" and "rv.scaled.bw" using IGV to check each target location from the Track-seq result.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

offtracker-1.0.2.zip (4.0 MB view hashes)

Uploaded Source

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page