Transform human mtDNA sequence to variant sites and vice versa.
Project description
oldowan.mitomotifs is a small, pure Python, bioinformatic utility to (1) transform human mitochondral DNA sequence data into variant sites relative to the revised Cambridge Reference Sequence (rCRS) and (2) transform variant sites data into DNA sequence. Further information on the rCRS and variant site nomenclature for human mtDNA sequences is available at the MitoMotifs website.
Installation Instructions
This package is pure Python and has no dependencies outside of the standard library. The easist way to install is using easy_install from the setuptools package. This usually goes something like this:
$ easy_install oldowan.mitomotifs
or on a unix-like system, assuming you are installing to the main Python site-packages directory as a non-privileged user, this:
$ sudo easy_install oldowan.mitomotifs
You may also use the standard python distutils setup method. Download the current source archive from the file list towards the bottom of this page, unarchive it, and install. On Mac OS X and many other unix-like systems, having downloaded the archive and changed to the directory containing this archive in your shell, this might go something like:
$ tar xvzf oldowan.mitomotifs* $ cd oldowan.mitomotifs* $ python setup.py install
Quick Start
Import seq2sites and sites2seq from oldowan.mitomotifs:
>>> from oldowan.mitomotifs import seq2sites, sites2seq
Convert sequence to sites:
>>> seq = """TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAA GTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCC AGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGT ACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCA AGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAG CCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGT ACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATC CCTTCTCGTCCC""" >>> seq2sites(seq)
Sequences must be contiguous! Separate runs of sequence, such as HVR1 and HVR2 without the intervening sequence interval, must be analyzed separately.
There is also a cutoff on the number of ambigous sites (N) allowed in the sequence. By default, this is 10 - but this is an option that can be set:
>>> seq2sites(seq, ambig_cutoff=20)
Convert a list of variable sites to sequence. The default sequence region that is returned is hypervariable region 1 (HVR1), which is positions 16024 to 16365 of the rCRS (in biological one-based numbering):
>>> sites2seq('16129A 16223T')
Predefined sequence regions are:
HVR1: 16024-16365
HVR2: 73-340
HVR1to2: 16024-340
coding: 577-15992
all: 1-16559
So, to convert a list of HVR2 sites to sequence:
>>> sites2seq('73G', region='HVR2')
Sites may also be provided in a list:
>>> sites2seq(['16129A', '16223T', '73G'], region='HVR1to2')
The rCRS sequence will be returned given an empty string, empty list, or the string ‘rCRS’. All of the following are equivalent:
>>> sites2seq('') >>> sites2seq([]) >>> sites2seq('rCRS')
Arbitrary positions may be selected by passing a list of sites to the region option:
>>> sites2seq('', region=[1,2,3])
The Python range function is convenient for this, but you must remember that the range does not include it’s ending position:
>>> sites2seq('', region=range(73,341)) # include 340, but not 341
Release History ===============
- 1.0.0 (August 16, 2008)
initial release of module.
- 1.0.1 (August 22, 2008)
new ‘add16k’ option to sites2seq for abbreviated HVR1 sites (i.e. 16129A as 129A)
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Hashes for oldowan.mitomotifs-1.0.1-py2.5.egg
Algorithm | Hash digest | |
---|---|---|
SHA256 | c1abcf34302324d2970c50f016a128e71d911102e1444142ac23063a221048bd |
|
MD5 | 526f42660fbb601393fa5361ec14728b |
|
BLAKE2b-256 | 17e1df1d3b54bd72c97e19a052f986b9f5a41bacc709c5358796ddc9370a8a6a |