Skip to main content

A package for analyzing patterns in biological data.

Project description

pattern_analysis

https://img.shields.io/pypi/v/pattern_analysis.svg https://img.shields.io/travis/ScienceComputing/pattern_analysis.svg Documentation Status Updates

A package for analyzing patterns in biological data.

Features

  • Count patterns of nucleotide interest in a genome sequence

  • Generate the complement for a genome sequence

Usage

from pattern_analysis import pattern_analysis

# Estimate the number of patterns equal to "TGATCA" in the ori sequence
ori = "ATCAATGATCAACGTAAGCTTCTAAGCATGATCAAGGTGCTCACACAGTTTATCCACAACCTGAGTGGATGACATCAAGATAGGTCGTTGTATCTCCTTCCTCTCGTACTCTCATGACCACGGAAAGATGATCAAGAGAGGATGATTTCTTGGCCATATCGCAATGAATACTTGTGACTTGTGCTTCCAATTGACATCTTCAGCGCCATATTGCGCTGGCCAAGGTGACGGAGCGGGATTACGAAAGCATGATCATGGCTGTTGTTCTGTTTATCTTGTTTTGACTGAGACTTGTTAGGATAGACGGTTTTTCATCACTGACTAGCCAAAGCCTTACTCTGCCTGACATCGACCGTAAATTGATAATGAATTTACATGCTTCCGCGACGATTTACCTCTTGATCATCGATCCGATTGAAGATCTTCAATTGTTAATTCTCTTGCCTCGACTCATAGCCATGATGAGCTCTTGATCATGTTTCCTTAACCCTCTATTTTTTACGGAAGAATGATCAAGCTGCTGCTCTTGATCATCGTTTC"

pat = "TGATCA"
res = pattern_analysis.pattern_count(ori, pat)

print("A total of {} {} are found.".format(res, pat)) # Return "A total of 8 TGATCA are found."

Credits

This package was created with Cookiecutter and the audreyr/cookiecutter-pypackage project template.

History

0.1.1 (2023-12-17)

  • Restructure the pattern analysis package using cookiecutter-pypackage.

0.1.0 (2023-12-12)

  • First release on PyPI.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

pattern_analysis-0.1.2.tar.gz (10.4 kB view hashes)

Uploaded Source

Built Distribution

pattern_analysis-0.1.2-py2.py3-none-any.whl (4.2 kB view hashes)

Uploaded Python 2 Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page